ID: 1185831024

View in Genome Browser
Species Human (GRCh38)
Location X:3303245-3303267
Sequence GGACATGTGTCCATAGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185831024_1185831028 -1 Left 1185831024 X:3303245-3303267 CCTAAATCTATGGACACATGTCC No data
Right 1185831028 X:3303267-3303289 CTTATAAGAGACAGAGGACTGGG No data
1185831024_1185831025 -7 Left 1185831024 X:3303245-3303267 CCTAAATCTATGGACACATGTCC No data
Right 1185831025 X:3303261-3303283 CATGTCCTTATAAGAGACAGAGG No data
1185831024_1185831027 -2 Left 1185831024 X:3303245-3303267 CCTAAATCTATGGACACATGTCC No data
Right 1185831027 X:3303266-3303288 CCTTATAAGAGACAGAGGACTGG No data
1185831024_1185831030 8 Left 1185831024 X:3303245-3303267 CCTAAATCTATGGACACATGTCC No data
Right 1185831030 X:3303276-3303298 GACAGAGGACTGGGAGGCTGAGG No data
1185831024_1185831032 30 Left 1185831024 X:3303245-3303267 CCTAAATCTATGGACACATGTCC No data
Right 1185831032 X:3303298-3303320 GCAGGAGAATCGCCTGAACCTGG 0: 852
1: 45035
2: 162824
3: 124835
4: 67143
1185831024_1185831029 2 Left 1185831024 X:3303245-3303267 CCTAAATCTATGGACACATGTCC No data
Right 1185831029 X:3303270-3303292 ATAAGAGACAGAGGACTGGGAGG No data
1185831024_1185831031 12 Left 1185831024 X:3303245-3303267 CCTAAATCTATGGACACATGTCC No data
Right 1185831031 X:3303280-3303302 GAGGACTGGGAGGCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185831024 Original CRISPR GGACATGTGTCCATAGATTT AGG (reversed) Intergenic
No off target data available for this crispr