ID: 1185831428

View in Genome Browser
Species Human (GRCh38)
Location X:3306549-3306571
Sequence CTGCATGTATTTATCTAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185831425_1185831428 6 Left 1185831425 X:3306520-3306542 CCAAATGAACGTGTTTCTAAAAC No data
Right 1185831428 X:3306549-3306571 CTGCATGTATTTATCTAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185831428 Original CRISPR CTGCATGTATTTATCTAGCA CGG Intergenic
No off target data available for this crispr