ID: 1185831625

View in Genome Browser
Species Human (GRCh38)
Location X:3308698-3308720
Sequence CTTGTCCATCTGGTCTAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185831625_1185831631 11 Left 1185831625 X:3308698-3308720 CCACCTTAGACCAGATGGACAAG 0: 2
1: 0
2: 1
3: 7
4: 113
Right 1185831631 X:3308732-3308754 AGAGAAGTTTCTGGGCTTTTCGG 0: 1
1: 0
2: 1
3: 22
4: 291
1185831625_1185831633 13 Left 1185831625 X:3308698-3308720 CCACCTTAGACCAGATGGACAAG 0: 2
1: 0
2: 1
3: 7
4: 113
Right 1185831633 X:3308734-3308756 AGAAGTTTCTGGGCTTTTCGGGG 0: 1
1: 0
2: 1
3: 14
4: 157
1185831625_1185831629 2 Left 1185831625 X:3308698-3308720 CCACCTTAGACCAGATGGACAAG 0: 2
1: 0
2: 1
3: 7
4: 113
Right 1185831629 X:3308723-3308745 AGATACTGCAGAGAAGTTTCTGG 0: 2
1: 0
2: 2
3: 24
4: 280
1185831625_1185831632 12 Left 1185831625 X:3308698-3308720 CCACCTTAGACCAGATGGACAAG 0: 2
1: 0
2: 1
3: 7
4: 113
Right 1185831632 X:3308733-3308755 GAGAAGTTTCTGGGCTTTTCGGG 0: 1
1: 1
2: 3
3: 30
4: 307
1185831625_1185831630 3 Left 1185831625 X:3308698-3308720 CCACCTTAGACCAGATGGACAAG 0: 2
1: 0
2: 1
3: 7
4: 113
Right 1185831630 X:3308724-3308746 GATACTGCAGAGAAGTTTCTGGG 0: 2
1: 0
2: 1
3: 26
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185831625 Original CRISPR CTTGTCCATCTGGTCTAAGG TGG (reversed) Exonic
900465834 1:2825068-2825090 TTTGTCCCTCTGGTCTGATGGGG + Intergenic
902738260 1:18415487-18415509 CTTGACCTCCTGGTCTCAGGTGG - Intergenic
904348950 1:29892591-29892613 TTTGTCCATCTGGGCTGAAGAGG - Intergenic
905902443 1:41590502-41590524 CTTGTCCATGTGGTCACAGTTGG - Intronic
905977481 1:42187428-42187450 GTGGTACACCTGGTCTAAGGAGG + Intronic
907246034 1:53109787-53109809 CTTGTCCGTCTGTCCTAAGATGG + Intronic
916742305 1:167656825-167656847 CTTTTCCATCTGCTCTAAAGGGG + Intronic
917050485 1:170916882-170916904 TGTGTCCATCTGGGCTAGGGAGG + Intergenic
921798885 1:219379357-219379379 AATGTACATCTGGTCTGAGGTGG - Intergenic
922684557 1:227629174-227629196 CTTGTGCCTCGGGTCTAAGGGGG + Intronic
923125809 1:231033487-231033509 CTTGCCCACCTGGCCTCAGGGGG + Intronic
1076338214 10:129724888-129724910 CTTCACCATCTGGGATAAGGAGG - Intronic
1081539152 11:44017512-44017534 TTTGTCCACCTGGCCTATGGGGG + Intergenic
1085121103 11:73968180-73968202 CTAATCCATCTGGGCTATGGGGG + Intronic
1088689163 11:112310736-112310758 CCTGGCCATCTGTTCAAAGGAGG + Intergenic
1093961880 12:25282735-25282757 CTTGACTTTCTGGTCCAAGGTGG - Intergenic
1096450136 12:51733054-51733076 CTTGTCCAATTGCTCTAAGTAGG + Intronic
1099102699 12:78461659-78461681 CTTTTACACCTGGTCTAAAGTGG + Intergenic
1104613610 12:130250502-130250524 CTTGGCCATCTGGTCTAACCTGG + Intergenic
1105337202 13:19484473-19484495 TATGTCCATTTGGTCTATGGTGG + Intronic
1106575177 13:30967849-30967871 ATTGTCCATTTGGACTAATGGGG - Intronic
1107630449 13:42337347-42337369 CGTGTCCATGAGGTGTAAGGTGG - Intergenic
1107634137 13:42374917-42374939 GTATTACATCTGGTCTAAGGGGG - Intergenic
1111820664 13:93209998-93210020 CATGTCCATCTGATCGAAGCTGG - Intergenic
1113671436 13:112178228-112178250 CTTGTCCATCTCATCTCAGCAGG + Intergenic
1114264574 14:21065623-21065645 CCTGGCCACCTGGTCTAAAGTGG - Intronic
1114532266 14:23403433-23403455 CTTCTCCAGCAGGTCTGAGGTGG + Exonic
1114673529 14:24427381-24427403 CTTGTCCATCTGGGCTCCTGTGG + Exonic
1116128893 14:40827465-40827487 CTTGTACATCTGGTAGAATGTGG - Intergenic
1116703177 14:48265197-48265219 CTTATCCTTGTGGTTTAAGGTGG + Intergenic
1121120557 14:91373205-91373227 CTTCTCCCTCTGGCCTCAGGAGG + Intronic
1121267898 14:92616130-92616152 CCTGCCCATCTGGACTCAGGAGG - Intronic
1121467520 14:94125685-94125707 TTTGACCATCTCATCTAAGGAGG + Intergenic
1125001330 15:34773296-34773318 CTTCTCCATCTGTTATATGGAGG + Intergenic
1127777013 15:62271843-62271865 CTGATTCATCAGGTCTAAGGTGG - Intergenic
1127949206 15:63787874-63787896 CTTGACCTTCTGGACTCAGGCGG - Intronic
1129562169 15:76582099-76582121 CTTGTCCAATTGGTCTAGGTAGG - Intronic
1130723728 15:86416535-86416557 GATGTCCATCTGATCTCAGGTGG + Intronic
1135196521 16:20399381-20399403 CTTGTCCAGCTGGTCCATGTAGG + Intronic
1136492806 16:30621528-30621550 ACTGTCCATCTGGTCTGAGACGG + Intronic
1141731773 16:85827841-85827863 CTTGTGCATCTGGTGTGGGGTGG - Intergenic
1144082633 17:11778636-11778658 CTTGTCCATCTGCTCTCACCTGG - Intronic
1144479998 17:15621404-15621426 CTTGTCCCTCTATTCTCAGGAGG - Intronic
1144918303 17:18742342-18742364 CTTGTCCCTCTATTCTCAGGAGG + Intergenic
1147392015 17:40115290-40115312 CTTATTCATTAGGTCTAAGGTGG + Intergenic
1148435127 17:47678167-47678189 CTTGTCCACCTGGGCTTGGGAGG - Exonic
1153014217 18:568819-568841 CTTGTCTACGTGGTCTAAGCCGG - Intergenic
1156313512 18:35946797-35946819 CTTGACCATCTGGTATTTGGAGG + Intergenic
1165707490 19:37986888-37986910 CTCATTCATCTGGTCTGAGGAGG + Intronic
1165827987 19:38716511-38716533 CTTTTCCCTCAGGTCTAAGAGGG - Intronic
927089600 2:19700513-19700535 CTTGTACTTCTGGCCTTAGGTGG - Intergenic
927813383 2:26193182-26193204 CTTGTCCATCTGGCATAACTTGG + Intronic
928471969 2:31583858-31583880 CTTCTCCATGTGGTCTTGGGTGG - Intergenic
940065357 2:149621769-149621791 TTAGTCCATCTGTGCTAAGGAGG - Intergenic
942929163 2:181469327-181469349 CTTGTCCATGTGGTCCAGGATGG + Intronic
944278837 2:197871360-197871382 CTATTCCCTCTGGTCTCAGGAGG - Intronic
945170651 2:206991203-206991225 ATTCTCCATCTGGTCAAAGATGG - Intergenic
947243341 2:228019698-228019720 CTTCTCCATCTTGTCTAGGAGGG + Exonic
1169909482 20:10635915-10635937 CTGGTGCATCTGGTCTAATAGGG + Intronic
1172269088 20:33643111-33643133 CTTGTTCATCTTGTGAAAGGTGG + Intronic
1174134827 20:48372388-48372410 CTTGTCCACCTGGTCCAAGGAGG - Intergenic
1174554846 20:51386635-51386657 CTTGGAAAGCTGGTCTAAGGTGG + Intergenic
1176736363 21:10550730-10550752 TATGTCCATTTGGTCTATGGTGG - Intronic
1178581406 21:33841580-33841602 CTTGCTCATTTGGTCTAAGAAGG + Intronic
1182204203 22:28607025-28607047 CCTTTCCATCAGGTTTAAGGAGG - Intronic
1182272174 22:29161596-29161618 CTTGTACATCTGGTGGAATGTGG - Intronic
1183532778 22:38371962-38371984 TATGTCCATTTGGTCTATGGTGG + Intronic
953683616 3:45059174-45059196 CTTGTCCCTTTGGTCTAAGCAGG - Intergenic
958161902 3:89827976-89827998 CTTGCCCATCTTGTCTACAGAGG + Intergenic
960577815 3:119244793-119244815 TTTGTCTATCTGTTCTAAGATGG + Intergenic
961002517 3:123383559-123383581 CTTGTCCATCTCCAGTAAGGTGG - Intronic
964543791 3:157810083-157810105 CTTGTTCATCTTGTTTAAGCTGG + Intergenic
966604066 3:181804690-181804712 CTTGTCACTGTGGTATAAGGAGG + Intergenic
966769099 3:183488331-183488353 CTTGTGCCTCTGCTCTAAGAAGG + Exonic
967955457 3:194874338-194874360 CTTCTCCTCCTGGTCTCAGGTGG + Intergenic
968081794 3:195851523-195851545 CCTGTCCAGTTGGTCTGAGGGGG + Intergenic
968089934 3:195893394-195893416 CTTGGCCACCTGGTCTGAGTAGG - Intronic
969047151 4:4344679-4344701 CTGATTCATCTGCTCTAAGGCGG + Intergenic
972901176 4:43685548-43685570 TTTGTCTATGTGGTCTAAGGTGG - Intergenic
974950084 4:68576843-68576865 CCTGATCATCTGGTCTTAGGGGG + Intronic
975128837 4:70812138-70812160 GTTTTCCTTCTGGTCTTAGGAGG - Intergenic
976728849 4:88242843-88242865 CTTGTCTTTCTGGTATAAGGAGG - Intergenic
976926937 4:90510882-90510904 CTTGTCCATGTGGTCATCGGAGG - Intronic
981823418 4:148912627-148912649 CTTGTCCACCAGGTACAAGGTGG + Intergenic
986110001 5:4705673-4705695 TTTGTCCATTTGATCTAAGTTGG + Intergenic
998267587 5:140677655-140677677 CTTGTCCAGCTTGTCTACTGAGG + Exonic
1000699317 5:164428625-164428647 CTTGTCCCTGTGGTTTAAGTGGG + Intergenic
1001134977 5:169094998-169095020 CTGGTCCCTGTGGTTTAAGGTGG - Intronic
1003180633 6:3788535-3788557 CTTGGGCATGTGGTCTAAGCAGG - Intergenic
1006518612 6:34558538-34558560 CTTGTCCTCATGGTCTAAGATGG - Intergenic
1008588448 6:52970139-52970161 CTTGTCCAGCTGGCCTAGGTGGG - Intergenic
1016129145 6:140443835-140443857 CTTCTCCCTCTGGTCTAAGAAGG + Intergenic
1021485425 7:21162776-21162798 CTTGTTCAATTGGTCTAGGGAGG + Intergenic
1021815345 7:24442036-24442058 CTAGTCCCTCTGGTCTAAAAAGG - Intergenic
1023286088 7:38621741-38621763 TTTGTACATCTGTTCTAAGTAGG + Intronic
1024102902 7:46050972-46050994 CTTGTCCATCTGGGCTTGGCAGG + Intergenic
1024955598 7:54915912-54915934 CTTCTCCATCTGGTCTTGGCAGG + Intergenic
1026853931 7:73740950-73740972 CTTGTTCATCTGGTGCAAAGTGG + Intergenic
1028255700 7:88594807-88594829 CTTGTACATCTGGTAAAATGTGG - Intergenic
1031001314 7:116418462-116418484 CTGTTCTATCTGTTCTAAGGAGG - Intronic
1032760004 7:134931813-134931835 CTTGTCCATCTTTTCTACAGTGG - Intronic
1033758386 7:144416167-144416189 CTTCTCCATCTTGAATAAGGAGG - Intergenic
1041272374 8:56121892-56121914 CGAGTCGATCTGGGCTAAGGAGG + Intergenic
1042358839 8:67859616-67859638 CTTGGCCATCTCGGCTCAGGAGG + Intergenic
1046036865 8:108853245-108853267 CTTGTGCATCTGGTTTTATGTGG + Intergenic
1050869842 9:10553137-10553159 CCTGTCCATCCAGCCTAAGGAGG + Intronic
1051852520 9:21526320-21526342 CTTTTCTATATGGTATAAGGAGG + Intergenic
1057161074 9:92888809-92888831 CTTGTCCTTCTGGTATGATGGGG - Intergenic
1057952777 9:99383191-99383213 CTTGTCCATATGACCTAATGAGG - Intergenic
1058538192 9:105984730-105984752 CCCATCCATCTGGTCTAATGTGG + Intergenic
1061218410 9:129235208-129235230 CTTGCCCATCTGTTCTACGAGGG + Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1062470856 9:136703592-136703614 CATGTCCTGCTGCTCTAAGGGGG + Intergenic
1062722628 9:138052391-138052413 CTGGTCCTGCTGGGCTAAGGAGG - Intronic
1062725660 9:138072019-138072041 CTTGGCCATCTTGTCTACCGTGG + Intronic
1062744298 9:138201670-138201692 CTTGTGCAGCTGGTCTAGGATGG + Intergenic
1185831625 X:3308698-3308720 CTTGTCCATCTGGTCTAAGGTGG - Exonic
1187188488 X:17010594-17010616 CTTGTCCAGTTTGTGTAAGGGGG + Intronic
1190069277 X:47266200-47266222 CATGGCCATCTGGTTTAATGGGG - Intergenic
1191663577 X:63675057-63675079 CTTGTCCTTATGGTCCAAGATGG - Intronic
1192253707 X:69436306-69436328 CTTGTACCTCTGGTAGAAGGAGG - Intergenic
1201244372 Y:11988429-11988451 CTTGTCCATCTGGTCTAAGGTGG + Intergenic
1201899105 Y:19028332-19028354 CTTGGCCATGTAGTCTAATGGGG - Intergenic