ID: 1185835571

View in Genome Browser
Species Human (GRCh38)
Location X:3343786-3343808
Sequence CAGGATCAGCACCACGGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185835564_1185835571 -1 Left 1185835564 X:3343764-3343786 CCACTCGCGGATGGCCCCAAAGC 0: 1
1: 1
2: 0
3: 4
4: 43
Right 1185835571 X:3343786-3343808 CAGGATCAGCACCACGGAGAGGG 0: 1
1: 1
2: 1
3: 24
4: 239
1185835563_1185835571 5 Left 1185835563 X:3343758-3343780 CCAGCGCCACTCGCGGATGGCCC 0: 1
1: 1
2: 2
3: 1
4: 88
Right 1185835571 X:3343786-3343808 CAGGATCAGCACCACGGAGAGGG 0: 1
1: 1
2: 1
3: 24
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185835571 Original CRISPR CAGGATCAGCACCACGGAGA GGG Exonic
902325303 1:15696247-15696269 CAAGACCAACACCATGGAGAAGG - Intronic
905211990 1:36380790-36380812 CTGAATCAGCACCTGGGAGAAGG - Intronic
905345108 1:37306031-37306053 CAGGTTCAGCCCCAGAGAGAGGG - Intergenic
906183277 1:43839924-43839946 CAAGAACAGCACCAGGGGGATGG + Intronic
908580602 1:65512210-65512232 CAAGAACAGCACCAAGGGGATGG + Intronic
911885276 1:103289722-103289744 TAAGAACAGCACCAAGGAGATGG - Intergenic
912506684 1:110161508-110161530 CAGGATCAGGAGCACGGGGAGGG + Intronic
913233773 1:116763300-116763322 CAGGATGGGCCCCAAGGAGAGGG - Intronic
916144430 1:161726691-161726713 CCGGAACAGCTCTACGGAGAGGG - Exonic
917515256 1:175701764-175701786 GAGGAGCAGCACCAGGGAGCTGG + Intronic
918141097 1:181720544-181720566 CAGGGACAGCACCAAAGAGATGG - Intronic
919755925 1:201066286-201066308 CAGGATCTTCACCACGGAGATGG + Exonic
1065444117 10:25780124-25780146 CAAGAACAGCACCAAGGGGATGG + Intergenic
1067222983 10:44357230-44357252 CAGGATTAACACCCCGGAGTTGG + Intergenic
1070443602 10:76471038-76471060 CAGTAACAGCACAATGGAGATGG + Intronic
1070581885 10:77726965-77726987 CAAGAACAGCACCAAGGAAATGG + Intergenic
1071495858 10:86167276-86167298 GAGGATGAGCATCAGGGAGAAGG + Intronic
1072433234 10:95392156-95392178 CTGGAGCAGCACCACGGACAGGG + Intronic
1073701589 10:105933898-105933920 CAAGAACAGCACCAAGGAGATGG - Intergenic
1075309155 10:121397329-121397351 CAAAAACAGCACCAAGGAGACGG + Intergenic
1076887354 10:133268825-133268847 CAGAACCACCACCACGAAGACGG + Exonic
1076898320 10:133325078-133325100 CAGGCCCAGCACCAGGTAGATGG + Intronic
1077036107 11:495216-495238 CAGGTTCCCCACCACGGACAAGG + Intronic
1077131175 11:973527-973549 CAGGAGCAGAACCACCGAGCCGG + Intronic
1077297104 11:1831492-1831514 CAGGTTCTGCACGACGGGGAGGG - Intronic
1078337438 11:10475268-10475290 CTAGAACAGCACCAAGGAGATGG + Intronic
1079109874 11:17599333-17599355 CAGGATTAGAACCAAGGAGTGGG - Intronic
1079266055 11:18934274-18934296 CAGAATCAGCACCACTGAACAGG + Exonic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084218692 11:67665113-67665135 CAGGCTCAGAAGCACAGAGACGG + Intronic
1084627976 11:70323482-70323504 CAGCATCAGCACCACGTAGCTGG + Intronic
1084749910 11:71197859-71197881 CATGCTCAGCCCCACGGAAAGGG + Intronic
1088135548 11:106552232-106552254 CAGGAGCTGCTCCACGGAGGGGG + Intergenic
1088811689 11:113396658-113396680 CAGGATCTGCATCACGGGGCTGG + Intronic
1089281114 11:117375180-117375202 CTGGTTGGGCACCACGGAGAGGG + Intronic
1089326512 11:117661167-117661189 CTGGATCATCAACCCGGAGAAGG - Intronic
1089696938 11:120221770-120221792 CAGGATCTGGGCCACGCAGAGGG - Intronic
1090790087 11:130084670-130084692 CAGCAAAAGCACCACTGAGAGGG + Intronic
1090939875 11:131377838-131377860 CATGATCACCACCACCGTGATGG - Intronic
1091084243 11:132705236-132705258 CAAGAACAGCACCAAGGGGATGG - Intronic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1091866220 12:3839289-3839311 CAGGACCAGCAACATGGAGGCGG + Intronic
1092211100 12:6647002-6647024 CAGGAGCAGCACTGCGGAGCGGG + Exonic
1094242348 12:28242817-28242839 CAAGAACAGCACCACACAGAGGG - Intronic
1094322902 12:29204846-29204868 CGGGAACAGCACCAAGGAGATGG + Intronic
1096229570 12:49889535-49889557 CAGGCACAGCAGCACGGAGGTGG + Exonic
1096673409 12:53213632-53213654 CAGGGTCAGCCCGTCGGAGAAGG + Exonic
1099658564 12:85526470-85526492 CCAGAACAGCACCAAGGAGATGG - Intergenic
1100194307 12:92226949-92226971 CAGGGACAACACCAGGGAGATGG - Intergenic
1101645198 12:106624991-106625013 CAGTATCAGCACCAGGGACCTGG + Intronic
1104827240 12:131721142-131721164 CGGGAGCAGCACCGAGGAGATGG + Intronic
1106463420 13:29992205-29992227 CAAGAACAGTACCAAGGAGATGG - Intergenic
1107310448 13:39072390-39072412 CTGGTTCATCACCATGGAGAAGG - Intergenic
1107699421 13:43033078-43033100 CAGGAATAGCACCAAGGGGATGG + Intronic
1108063332 13:46553608-46553630 CAGGTTCAGCCCCCCGGAGTTGG - Exonic
1108327817 13:49351681-49351703 CAGGAGCAGAACCCAGGAGAGGG + Intronic
1108796186 13:54033496-54033518 CAGGCTCAACACCACGTGGAAGG + Intergenic
1110411300 13:75206186-75206208 CATGAACAGCACCAAGGGGATGG + Intergenic
1110929006 13:81192684-81192706 CAAGAGCAGTACCAAGGAGATGG - Intergenic
1114140226 14:19901319-19901341 CAGGATTAACACCACATAGAAGG - Intergenic
1118538392 14:66794218-66794240 CAAGAACAGCACCAAGGGGATGG - Intronic
1120197779 14:81504769-81504791 CAAGAACAGCACCAAGGGGATGG - Intronic
1120707915 14:87763394-87763416 CAAGAACAGCACCAAGGGGATGG + Intergenic
1121372810 14:93375748-93375770 CGGGAACAGCACCAAGGGGATGG + Intronic
1124222751 15:27864159-27864181 CAGGCTCAGCACCAAGCAAATGG + Intronic
1124920593 15:34022527-34022549 CAGGATCAGGACTACGCAGCAGG + Intronic
1125262282 15:37840630-37840652 CAAGAACAGCACCACAGGGATGG + Intergenic
1127217014 15:56833995-56834017 CAGGAGCAACACCCCAGAGATGG - Intronic
1127357783 15:58217439-58217461 CAAGAACAGCACCAGGGGGATGG + Intronic
1128058336 15:64717595-64717617 CAGGATCAGCAGCCAGGAAAAGG - Intergenic
1137004093 16:35256012-35256034 CAGGAACAGCAGCAAGGAGAGGG - Intergenic
1137537663 16:49339765-49339787 CAGGATCAGCCTCACTGAGAAGG + Intergenic
1138705598 16:58912060-58912082 CAAGAACAGCACCAGGGGGATGG - Intergenic
1139477673 16:67210803-67210825 CAGGATCAGGGCCACAGAGGAGG + Exonic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1139974449 16:70797746-70797768 CAAGAACAGCACCAAGAAGATGG - Intronic
1140122460 16:72095431-72095453 CAGGTACAGCAGCACAGAGATGG - Intronic
1142276125 16:89119776-89119798 CAGGATCAGCAAGACCGAGCCGG + Intronic
1142909219 17:3072683-3072705 CAGAACCAGCACCTCCGAGAAGG - Intergenic
1142925341 17:3231555-3231577 CAGAACCAGCACCTCCGAGAAGG + Intergenic
1143427319 17:6850285-6850307 CGAGAACAGCACCAAGGAGATGG - Intergenic
1145762722 17:27435346-27435368 CAGGACCAGCACCTGTGAGAGGG - Intergenic
1147159858 17:38563508-38563530 CAGGAACAGCACCCCTGCGAAGG + Exonic
1147540446 17:41352768-41352790 CATGATCAGGACCATGGAGAGGG + Intergenic
1147687320 17:42294345-42294367 CAGCACCAGCACCATGGACATGG - Intronic
1149110228 17:53019429-53019451 CAGGCTCAGTACCACGTGGAAGG + Intergenic
1149232924 17:54555611-54555633 CAGGATCAGCAGCAGGGAAGAGG - Intergenic
1150647458 17:66988202-66988224 CAGGATGAGCTCCAGGCAGATGG - Intronic
1151250667 17:72831828-72831850 CAGCTTCAGCAACACAGAGATGG - Intronic
1151449698 17:74190978-74191000 GTGGGTCAGCACCACGGACAGGG - Intergenic
1154384101 18:13878068-13878090 CAGGAGCAGTACCACAGAAACGG - Intergenic
1155398751 18:25415716-25415738 TGGGCTCAGCACCACGGAAATGG - Intergenic
1155930397 18:31701202-31701224 CAAGAACAGCACCAAGGAGATGG - Intergenic
1156582015 18:38388326-38388348 CAGTATCATCACCAAGGTGATGG - Intergenic
1158125239 18:54093655-54093677 CAAGAGCAGCACCAAGGGGATGG + Intergenic
1158566387 18:58557374-58557396 CAGAATGGGCACCACCGAGAGGG + Intronic
1159314857 18:66759171-66759193 CAGAATCAGGCCCATGGAGAAGG - Intergenic
1159728559 18:71995124-71995146 CAGGAACAGCACCAAAGGGATGG + Intergenic
1161684597 19:5696547-5696569 CAGGGCCAGCATCACGGCGATGG + Intronic
1162162859 19:8731627-8731649 TAGGATCAGCACCCCTGAGGTGG - Exonic
1162183492 19:8886750-8886772 GAAGTTCAACACCACGGAGAGGG - Exonic
1162184341 19:8892904-8892926 GAAGTTCAACACCACGGAGAGGG - Exonic
1162327900 19:10009570-10009592 CGCGATCAGCACCATGGACAGGG - Intronic
1165792861 19:38502509-38502531 CACTTTCAGCACCACCGAGATGG + Exonic
1167426730 19:49433497-49433519 CAGGATTAGAACCACTGACAGGG - Intronic
1168093466 19:54100772-54100794 GAGGATCAGCACCAGGGCCATGG + Exonic
925951535 2:8917552-8917574 CAGAATGAGCACCATGGAAAAGG + Intronic
926314318 2:11698072-11698094 CAGGATCAGGACCTGAGAGAGGG - Intronic
926326199 2:11786480-11786502 CAGGATCAGAGCAAAGGAGAAGG - Intronic
927145923 2:20166526-20166548 CAGGGTCAGCCCCCAGGAGATGG - Intergenic
928391083 2:30911560-30911582 CAGGGGAAGCACCCCGGAGAGGG + Intronic
928850929 2:35745280-35745302 CAATATCAGCACAAAGGAGAAGG + Intergenic
930773605 2:55151590-55151612 CATGATAGGCACCACAGAGAAGG - Intergenic
931983749 2:67721871-67721893 CAGGATCAACACCATGTGGAAGG - Intergenic
932465691 2:71922689-71922711 CAGGCTCTGCACCACAGTGAAGG + Intergenic
933742346 2:85544397-85544419 GAGCATAAGCACCAGGGAGATGG - Exonic
934606193 2:95697175-95697197 CAGGAAAAGCTCCACTGAGAAGG + Intergenic
935158377 2:100505343-100505365 CTGGAAGAGCACCAAGGAGATGG - Intergenic
935164138 2:100554962-100554984 CAGCAGCAGCAGCACAGAGAGGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
936539600 2:113339391-113339413 CAGGAAAAGCTCCACTGAGAAGG + Intergenic
936874588 2:117172962-117172984 CAAGAACAGCACCAAGAAGATGG - Intergenic
937296786 2:120814272-120814294 CAGGATCTGCCCTACAGAGATGG + Intronic
937630942 2:124100238-124100260 CAGGGACAGCACCAAGAAGATGG + Intronic
937646320 2:124269549-124269571 CATGATAAGCACCAGGGAGAGGG + Intronic
937995127 2:127688218-127688240 CAGTAACAGCACAAAGGAGATGG - Intergenic
938691118 2:133790271-133790293 CAGGATCTTCATCATGGAGAAGG - Intergenic
943142724 2:184002735-184002757 CAATATCAGCACCAAGGAGATGG + Intergenic
944684886 2:202109552-202109574 CAGAATCAGCAGGAAGGAGAAGG - Intronic
947384414 2:229576981-229577003 CAGGGTCCAGACCACGGAGAAGG + Intronic
947399297 2:229715160-229715182 CTGGGTCAGCACCAAGGACAAGG - Intergenic
947729069 2:232418286-232418308 CAGTATCTGCACCACGGGAAGGG + Intergenic
948126946 2:235571145-235571167 CAGGAACAGCACCAAGGGGACGG + Intronic
948661994 2:239513228-239513250 CGAGAACAGCACCAAGGAGATGG - Intergenic
1169224745 20:3848925-3848947 CAGGATGGGAACCACAGAGATGG - Intronic
1169395328 20:5223995-5224017 CAGGAACTGCACCACAGAGCTGG - Intergenic
1172468185 20:35172498-35172520 GAGAATCAGCCCCAGGGAGAGGG + Intronic
1172840799 20:37901922-37901944 CGGTTTCAGCACCACGGAGGAGG - Intergenic
1172947095 20:38697934-38697956 CAGGATGGGCACCAGGGAGTGGG - Intergenic
1173827545 20:46057398-46057420 CCGGATCAGCACCTCGGACAGGG + Intronic
1175152563 20:56946606-56946628 CAGGGTGAGCACAACGGACACGG + Intergenic
1176690739 21:9905117-9905139 CAAGAACAGCTCCAAGGAGATGG + Intergenic
1177017921 21:15815146-15815168 CAGGCTCAACACCACGTGGAAGG - Intronic
1177177269 21:17713733-17713755 CTTTATCAGCACCACGGAAACGG - Intergenic
1178531192 21:33377639-33377661 CAGTGTCAGCAGCACAGAGAAGG + Intergenic
1181117888 22:20645074-20645096 CAGCATCAGCACCGGGCAGATGG - Intergenic
1181985091 22:26794908-26794930 CGAGAACAGCACCAAGGAGATGG - Intergenic
1182563135 22:31177398-31177420 CAGGATCAGAAGAACAGAGAAGG - Intronic
1183954408 22:41370762-41370784 CAGGGGCAGCACGAGGGAGAGGG - Intronic
954602820 3:51884004-51884026 CAGGAACAGCACCAAGGGGATGG + Intergenic
954701284 3:52452184-52452206 CTGCATCAGCACCAAGGAGCTGG - Exonic
954867837 3:53744748-53744770 CAGAATCTTCACAACGGAGATGG - Exonic
954926030 3:54235517-54235539 CAAGAACAGCACCAAGGGGATGG + Intronic
955725301 3:61926315-61926337 CAAGAACAGCACCAAGGGGATGG - Intronic
958822282 3:98989107-98989129 CAAGAACAACACCAAGGAGATGG - Intergenic
959997640 3:112696262-112696284 GAGCATAAGCACCAGGGAGATGG + Intergenic
960059320 3:113303799-113303821 CAGACTCAGAACCACTGAGAAGG - Intronic
961360085 3:126361455-126361477 AAGGAGCAGCACCAAGGAGCAGG + Intergenic
961413652 3:126741936-126741958 CAGGAGCTGCATCAGGGAGAGGG - Intronic
962374515 3:134849174-134849196 CAGCATCAGAATCACGTAGAGGG + Intronic
962651235 3:137494805-137494827 CAGGTTCAGCCTCACTGAGAGGG - Intergenic
963510005 3:146235276-146235298 CAAGAACAGCACTAGGGAGATGG - Intronic
967318860 3:188176175-188176197 CAGCATCAGAACCTCTGAGACGG - Intronic
968809233 4:2792683-2792705 CAGGATCAGGACCACGGGGCTGG + Intergenic
969142657 4:5092744-5092766 CGAGAACAGCACCAAGGAGATGG + Intronic
969291188 4:6241195-6241217 CAGCATCAGCACCATGCTGAGGG - Intergenic
970352397 4:15215960-15215982 CAAGAACAGCACCAAGGAGATGG - Intergenic
970419114 4:15888526-15888548 CAGGAACAACACCAAGGGGATGG - Intergenic
971557979 4:28037938-28037960 CAAGAACAGCACCAAGGGGATGG + Intergenic
977015754 4:91691802-91691824 CAAGAGCAGTACCAAGGAGATGG + Intergenic
979304382 4:119125500-119125522 CAAGAAATGCACCACGGAGAAGG + Intergenic
980363315 4:131765345-131765367 CAAGAACAGCACCAAGGAGATGG + Intergenic
981121006 4:141051066-141051088 CAGGCTCAGCACCACAGGGAAGG + Intronic
981352581 4:143750051-143750073 CAAGAACAGCCCCAAGGAGATGG - Intergenic
983631447 4:169853423-169853445 CAGGAACAGCACCACAGGTATGG - Intergenic
983716767 4:170791049-170791071 CAAGAACAGCATCAAGGAGATGG - Intergenic
984701144 4:182819538-182819560 CTGGACCAGCACTGCGGAGATGG - Intergenic
985278922 4:188268385-188268407 CAGGGTTAGCACCACAGGGAGGG + Intergenic
986466925 5:8035000-8035022 CAGCAGCAGCACCAGGGAGGAGG + Intergenic
987287321 5:16469620-16469642 CTGGAACAGCACCAAGGGGATGG - Intergenic
987428926 5:17807550-17807572 CAGGAACAGCAGGATGGAGATGG + Intergenic
987650725 5:20736892-20736914 CAAGAACAGCACCAAGGGGATGG - Intergenic
991369234 5:65901061-65901083 CAGGAACAGCACCAAGTGGATGG + Intergenic
991938732 5:71829504-71829526 CAAGAACAGCACCAAGGGGATGG + Intergenic
993573526 5:89572350-89572372 CAGAATCAGAACCATGTAGAGGG - Intergenic
994403117 5:99307775-99307797 CAGCATCATCACCACTCAGATGG - Intergenic
994693067 5:103042059-103042081 CAAGAACAGCACCAAGGGGATGG - Intergenic
994798640 5:104340470-104340492 TAGGGTCAACACCAAGGAGAAGG - Intergenic
996188079 5:120504228-120504250 CAGAATCAGCACCAAGGTCAGGG - Intronic
996465636 5:123799423-123799445 CAGTATCAGCATCACTTAGATGG - Intergenic
998642087 5:144022480-144022502 CAAGAACAGCACCAAGCAGATGG - Intergenic
998991383 5:147821638-147821660 CAGGAACAGCACCAAAGGGATGG - Intergenic
1003191202 6:3876429-3876451 CAGGATCATCAGCAAAGAGAGGG - Intergenic
1003989719 6:11473587-11473609 CAGGGTCACCACCACCCAGAGGG + Intergenic
1004031135 6:11870588-11870610 CAGGATCATCTCCAAGGTGAAGG - Intergenic
1005868976 6:29959021-29959043 CAAGAACAGCACCAAAGAGATGG - Intergenic
1006154672 6:32007777-32007799 CAGGCGCAGCACCTCGGCGATGG - Intergenic
1006160984 6:32040512-32040534 CAGGCGCAGCACCTCGGCGATGG - Exonic
1006379512 6:33689331-33689353 CAGGATGAGCGCCACGATGAGGG - Exonic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1007906029 6:45461511-45461533 CAGTATCAACATCATGGAGAAGG + Intronic
1008262609 6:49385643-49385665 CAGGTTCAGCACAAAGCAGAGGG - Intergenic
1008277875 6:49562063-49562085 CAAGAGCAGCACCAAGGGGATGG - Intergenic
1008976848 6:57437124-57437146 CAGGAGCAGGAGCAAGGAGAGGG + Intronic
1011129078 6:84035625-84035647 CAGGATCAGCAACACAGAACAGG - Intronic
1012901284 6:105009660-105009682 CCAGATCAGCTCCACGAAGATGG + Intronic
1013937815 6:115619313-115619335 CAGGATCAGAACCTTTGAGATGG - Intergenic
1015286288 6:131489858-131489880 CAAGAGCAGCACCAAGGGGATGG + Intergenic
1016683097 6:146853023-146853045 CAAGAACAGCACCAAGGGGATGG + Intergenic
1016900286 6:149094082-149094104 CAGGAGCAGCATCAAGGTGATGG - Intergenic
1017166485 6:151412845-151412867 CAAGAACAGCACCAAGGGGATGG + Intronic
1017608481 6:156158492-156158514 CAGGATCAGCCCCAAGAATAAGG + Intergenic
1017630688 6:156393577-156393599 CAGCATCAGCACCATGCATATGG + Intergenic
1017997150 6:159541877-159541899 CAGGATCAGCTCCCCGGGGCTGG - Intergenic
1020009597 7:4800768-4800790 CAGGATCACCATTATGGAGAGGG - Intronic
1020119678 7:5496012-5496034 CAGGAGCAGGGCCATGGAGAAGG - Intronic
1020722899 7:11771827-11771849 CAAGAACAGCAGCAAGGAGATGG - Intronic
1021639972 7:22727462-22727484 CAGGAGCAGCCCCAGGGAGAAGG - Exonic
1021758696 7:23882031-23882053 CAAGAACAGCACCAAGAAGATGG + Intergenic
1025217303 7:57069627-57069649 CATGATCATCACAAGGGAGAGGG - Intergenic
1025654045 7:63500836-63500858 CATGATCATCACAAGGGAGAGGG + Intergenic
1026300605 7:69094695-69094717 CAAGGACAGCACCAAGGAGATGG + Intergenic
1026612032 7:71868668-71868690 CAAGACTAGCACCAAGGAGATGG + Intronic
1027440206 7:78211235-78211257 CAGGATCTGCCCCATGGGGAGGG + Intronic
1027785715 7:82576713-82576735 CAAGATCACCACCACAAAGAGGG + Intergenic
1030676887 7:112393693-112393715 CAAGAACAGCACCAAGGGGACGG - Intergenic
1032206475 7:129870203-129870225 CAGGAGCACCACCATCGAGAAGG - Intronic
1032282449 7:130515388-130515410 CAAGAACAGCACCAAGGGGATGG + Intronic
1034681374 7:152931017-152931039 CAAGAACAGCACCAAGGGGATGG + Intergenic
1036645457 8:10609295-10609317 CAGGAGCAGCTCCCCGGTGAGGG + Exonic
1037294965 8:17390369-17390391 CAAGAGCAGCACCAAGGCGATGG + Intronic
1043446086 8:80320531-80320553 CATGAACAGCCACACGGAGAGGG + Intergenic
1044894923 8:96881421-96881443 CAAGAACAGCACCAGGGGGATGG + Intronic
1046178037 8:110605192-110605214 CAGGAACAGCACCAACGGGATGG + Intergenic
1047721551 8:127644850-127644872 GAAGATCAGCACCACAGAAATGG - Intergenic
1048506639 8:135027571-135027593 CAAGAACAGCAGCAAGGAGACGG - Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1049354039 8:142179016-142179038 CGGGATCAGCAACCCGGGGAAGG + Intergenic
1049826177 8:144670305-144670327 CAGGATCAGCACCTGGGACCAGG + Intergenic
1049871626 8:144983307-144983329 CAAGAACAGCACCAGGGGGATGG - Intergenic
1053627471 9:39889631-39889653 CAAGAACAGCACCAAGGAGATGG + Intergenic
1053778520 9:41576390-41576412 CAAGAACAGCACCAAGGAGATGG - Intergenic
1054166482 9:61786634-61786656 CAAGAACAGCACCAAGGAGATGG - Intergenic
1054216416 9:62361072-62361094 CAAGAACAGCACCAAGGAGATGG - Intergenic
1054671065 9:67794271-67794293 CAAGAACAGCACCAAGGAGATGG + Intergenic
1055000699 9:71446568-71446590 CAAGTTCAGCACCATGGAAAGGG + Intronic
1055861627 9:80757082-80757104 CAGGAACAGCACCAAAGGGATGG + Intergenic
1058388834 9:104471080-104471102 CAAGGACAGCACCAAGGAGATGG + Intergenic
1058810011 9:108630379-108630401 CAGGCTCAACACCACGTGGAAGG - Intergenic
1060334282 9:122706696-122706718 CAAGAACAGCACCAAGAAGATGG + Intergenic
1062256005 9:135621096-135621118 CAGTATCAACACCACGGGAAAGG + Intergenic
1185835571 X:3343786-3343808 CAGGATCAGCACCACGGAGAGGG + Exonic
1186712343 X:12212450-12212472 TAGGAACAGCACCATGGGGATGG + Intronic
1187209011 X:17210524-17210546 CTAGAACAGCACCAAGGAGATGG + Intergenic
1187959806 X:24557839-24557861 TAGGAACAGCACCACGTGGAGGG - Intergenic
1188613093 X:32123433-32123455 CCAGATCAGCATCACGGGGATGG - Intronic
1190327989 X:49218512-49218534 CAGAATCTTCACCACCGAGATGG + Exonic
1192604046 X:72495155-72495177 TTGGATCTGCACCATGGAGATGG - Exonic
1194129370 X:90061279-90061301 CAAGAACAGCGCCAAGGAGATGG - Intergenic
1194595579 X:95852906-95852928 CAGAAGCAGCACCACTAAGAGGG + Intergenic
1195310957 X:103631303-103631325 AAGGATCAGGACCCAGGAGAAGG - Intergenic
1198239194 X:134766471-134766493 CAGGGTCAGAGCCAAGGAGATGG + Intergenic
1199371132 X:147049528-147049550 CAAGCTCAGCACAACTGAGAAGG + Intergenic
1199517907 X:148699482-148699504 AAGTATCAGCACCACCCAGATGG - Intronic
1199881554 X:151977409-151977431 CAGGATCAGAGCCACAGGGATGG + Intergenic
1201241120 Y:11957233-11957255 CAGGATCAGCACCACAGAGAGGG - Intergenic