ID: 1185835933

View in Genome Browser
Species Human (GRCh38)
Location X:3346107-3346129
Sequence TCTGCTCTTGCAATCGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185835933_1185835940 -7 Left 1185835933 X:3346107-3346129 CCCCCACCGATTGCAAGAGCAGA No data
Right 1185835940 X:3346123-3346145 GAGCAGAGTGGGCTTCACTTAGG No data
1185835933_1185835941 4 Left 1185835933 X:3346107-3346129 CCCCCACCGATTGCAAGAGCAGA No data
Right 1185835941 X:3346134-3346156 GCTTCACTTAGGAATTCCGTTGG No data
1185835933_1185835945 28 Left 1185835933 X:3346107-3346129 CCCCCACCGATTGCAAGAGCAGA No data
Right 1185835945 X:3346158-3346180 AGCTTCCTAGAAACGCGGGATGG No data
1185835933_1185835943 23 Left 1185835933 X:3346107-3346129 CCCCCACCGATTGCAAGAGCAGA No data
Right 1185835943 X:3346153-3346175 TTGGCAGCTTCCTAGAAACGCGG No data
1185835933_1185835944 24 Left 1185835933 X:3346107-3346129 CCCCCACCGATTGCAAGAGCAGA No data
Right 1185835944 X:3346154-3346176 TGGCAGCTTCCTAGAAACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185835933 Original CRISPR TCTGCTCTTGCAATCGGTGG GGG (reversed) Intronic