ID: 1185835936

View in Genome Browser
Species Human (GRCh38)
Location X:3346110-3346132
Sequence CACTCTGCTCTTGCAATCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185835936_1185835941 1 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835941 X:3346134-3346156 GCTTCACTTAGGAATTCCGTTGG No data
1185835936_1185835945 25 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835945 X:3346158-3346180 AGCTTCCTAGAAACGCGGGATGG No data
1185835936_1185835944 21 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835944 X:3346154-3346176 TGGCAGCTTCCTAGAAACGCGGG No data
1185835936_1185835946 28 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835946 X:3346161-3346183 TTCCTAGAAACGCGGGATGGCGG No data
1185835936_1185835940 -10 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835940 X:3346123-3346145 GAGCAGAGTGGGCTTCACTTAGG No data
1185835936_1185835947 29 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835947 X:3346162-3346184 TCCTAGAAACGCGGGATGGCGGG No data
1185835936_1185835943 20 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835943 X:3346153-3346175 TTGGCAGCTTCCTAGAAACGCGG No data
1185835936_1185835949 30 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835949 X:3346163-3346185 CCTAGAAACGCGGGATGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185835936 Original CRISPR CACTCTGCTCTTGCAATCGG TGG (reversed) Intronic