ID: 1185835943

View in Genome Browser
Species Human (GRCh38)
Location X:3346153-3346175
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185835936_1185835943 20 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835943 X:3346153-3346175 TTGGCAGCTTCCTAGAAACGCGG No data
1185835939_1185835943 17 Left 1185835939 X:3346113-3346135 CCGATTGCAAGAGCAGAGTGGGC No data
Right 1185835943 X:3346153-3346175 TTGGCAGCTTCCTAGAAACGCGG No data
1185835934_1185835943 22 Left 1185835934 X:3346108-3346130 CCCCACCGATTGCAAGAGCAGAG No data
Right 1185835943 X:3346153-3346175 TTGGCAGCTTCCTAGAAACGCGG No data
1185835935_1185835943 21 Left 1185835935 X:3346109-3346131 CCCACCGATTGCAAGAGCAGAGT No data
Right 1185835943 X:3346153-3346175 TTGGCAGCTTCCTAGAAACGCGG No data
1185835932_1185835943 28 Left 1185835932 X:3346102-3346124 CCTTTCCCCCACCGATTGCAAGA No data
Right 1185835943 X:3346153-3346175 TTGGCAGCTTCCTAGAAACGCGG No data
1185835933_1185835943 23 Left 1185835933 X:3346107-3346129 CCCCCACCGATTGCAAGAGCAGA No data
Right 1185835943 X:3346153-3346175 TTGGCAGCTTCCTAGAAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type