ID: 1185835947

View in Genome Browser
Species Human (GRCh38)
Location X:3346162-3346184
Sequence TCCTAGAAACGCGGGATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185835936_1185835947 29 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835947 X:3346162-3346184 TCCTAGAAACGCGGGATGGCGGG No data
1185835935_1185835947 30 Left 1185835935 X:3346109-3346131 CCCACCGATTGCAAGAGCAGAGT No data
Right 1185835947 X:3346162-3346184 TCCTAGAAACGCGGGATGGCGGG No data
1185835939_1185835947 26 Left 1185835939 X:3346113-3346135 CCGATTGCAAGAGCAGAGTGGGC No data
Right 1185835947 X:3346162-3346184 TCCTAGAAACGCGGGATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185835947 Original CRISPR TCCTAGAAACGCGGGATGGC GGG Intronic