ID: 1185835949

View in Genome Browser
Species Human (GRCh38)
Location X:3346163-3346185
Sequence CCTAGAAACGCGGGATGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185835939_1185835949 27 Left 1185835939 X:3346113-3346135 CCGATTGCAAGAGCAGAGTGGGC No data
Right 1185835949 X:3346163-3346185 CCTAGAAACGCGGGATGGCGGGG No data
1185835936_1185835949 30 Left 1185835936 X:3346110-3346132 CCACCGATTGCAAGAGCAGAGTG No data
Right 1185835949 X:3346163-3346185 CCTAGAAACGCGGGATGGCGGGG No data
1185835942_1185835949 -10 Left 1185835942 X:3346150-3346172 CCGTTGGCAGCTTCCTAGAAACG No data
Right 1185835949 X:3346163-3346185 CCTAGAAACGCGGGATGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185835949 Original CRISPR CCTAGAAACGCGGGATGGCG GGG Intronic