ID: 1185837603

View in Genome Browser
Species Human (GRCh38)
Location X:3359889-3359911
Sequence TCAGTGGTGCTGGGAGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185837603_1185837607 -3 Left 1185837603 X:3359889-3359911 CCAGGAGCTCCCAGCACCACTGA No data
Right 1185837607 X:3359909-3359931 TGAACTTACAAAGTGTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185837603 Original CRISPR TCAGTGGTGCTGGGAGCTCC TGG (reversed) Intergenic