ID: 1185837607

View in Genome Browser
Species Human (GRCh38)
Location X:3359909-3359931
Sequence TGAACTTACAAAGTGTCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185837600_1185837607 2 Left 1185837600 X:3359884-3359906 CCCCTCCAGGAGCTCCCAGCACC No data
Right 1185837607 X:3359909-3359931 TGAACTTACAAAGTGTCAATTGG No data
1185837602_1185837607 0 Left 1185837602 X:3359886-3359908 CCTCCAGGAGCTCCCAGCACCAC No data
Right 1185837607 X:3359909-3359931 TGAACTTACAAAGTGTCAATTGG No data
1185837599_1185837607 3 Left 1185837599 X:3359883-3359905 CCCCCTCCAGGAGCTCCCAGCAC No data
Right 1185837607 X:3359909-3359931 TGAACTTACAAAGTGTCAATTGG No data
1185837601_1185837607 1 Left 1185837601 X:3359885-3359907 CCCTCCAGGAGCTCCCAGCACCA No data
Right 1185837607 X:3359909-3359931 TGAACTTACAAAGTGTCAATTGG No data
1185837603_1185837607 -3 Left 1185837603 X:3359889-3359911 CCAGGAGCTCCCAGCACCACTGA No data
Right 1185837607 X:3359909-3359931 TGAACTTACAAAGTGTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185837607 Original CRISPR TGAACTTACAAAGTGTCAAT TGG Intergenic