ID: 1185839675

View in Genome Browser
Species Human (GRCh38)
Location X:3376904-3376926
Sequence CTAAGGTCCTTAAAATGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185839675_1185839680 8 Left 1185839675 X:3376904-3376926 CCGCAACATTTTAAGGACCTTAG No data
Right 1185839680 X:3376935-3376957 AGGGACCACCTGTGTTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185839675 Original CRISPR CTAAGGTCCTTAAAATGTTG CGG (reversed) Intergenic
No off target data available for this crispr