ID: 1185841179

View in Genome Browser
Species Human (GRCh38)
Location X:3392735-3392757
Sequence GAAAATGCACATATACACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185841176_1185841179 1 Left 1185841176 X:3392711-3392733 CCCATCCACAATAGACTGGCTAA No data
Right 1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG No data
1185841177_1185841179 0 Left 1185841177 X:3392712-3392734 CCATCCACAATAGACTGGCTAAA No data
Right 1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG No data
1185841174_1185841179 9 Left 1185841174 X:3392703-3392725 CCTAGGTGCCCATCCACAATAGA No data
Right 1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG No data
1185841178_1185841179 -4 Left 1185841178 X:3392716-3392738 CCACAATAGACTGGCTAAAGAAA No data
Right 1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185841179 Original CRISPR GAAAATGCACATATACACCA TGG Intergenic
No off target data available for this crispr