ID: 1185841179 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:3392735-3392757 |
| Sequence | GAAAATGCACATATACACCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185841176_1185841179 | 1 | Left | 1185841176 | X:3392711-3392733 | CCCATCCACAATAGACTGGCTAA | No data | ||
| Right | 1185841179 | X:3392735-3392757 | GAAAATGCACATATACACCATGG | No data | ||||
| 1185841177_1185841179 | 0 | Left | 1185841177 | X:3392712-3392734 | CCATCCACAATAGACTGGCTAAA | No data | ||
| Right | 1185841179 | X:3392735-3392757 | GAAAATGCACATATACACCATGG | No data | ||||
| 1185841174_1185841179 | 9 | Left | 1185841174 | X:3392703-3392725 | CCTAGGTGCCCATCCACAATAGA | No data | ||
| Right | 1185841179 | X:3392735-3392757 | GAAAATGCACATATACACCATGG | No data | ||||
| 1185841178_1185841179 | -4 | Left | 1185841178 | X:3392716-3392738 | CCACAATAGACTGGCTAAAGAAA | No data | ||
| Right | 1185841179 | X:3392735-3392757 | GAAAATGCACATATACACCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185841179 | Original CRISPR | GAAAATGCACATATACACCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||