ID: 1185842974

View in Genome Browser
Species Human (GRCh38)
Location X:3410433-3410455
Sequence GGCCATCTGGGAATTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185842974_1185842981 4 Left 1185842974 X:3410433-3410455 CCCCCTGGAATTCCCAGATGGCC No data
Right 1185842981 X:3410460-3410482 CTAGAAACGTTAGCCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185842974 Original CRISPR GGCCATCTGGGAATTCCAGG GGG (reversed) Intergenic
No off target data available for this crispr