ID: 1185845181

View in Genome Browser
Species Human (GRCh38)
Location X:3431110-3431132
Sequence CAAGCAGGGCCAAGAAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185845181_1185845187 0 Left 1185845181 X:3431110-3431132 CCTTGACTTCTTGGCCCTGCTTG No data
Right 1185845187 X:3431133-3431155 TCTCTCAGGGGAGAAAAAGTTGG No data
1185845181_1185845188 25 Left 1185845181 X:3431110-3431132 CCTTGACTTCTTGGCCCTGCTTG No data
Right 1185845188 X:3431158-3431180 ACCGCCAAAGAAAACAGCCTTGG No data
1185845181_1185845191 29 Left 1185845181 X:3431110-3431132 CCTTGACTTCTTGGCCCTGCTTG No data
Right 1185845191 X:3431162-3431184 CCAAAGAAAACAGCCTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185845181 Original CRISPR CAAGCAGGGCCAAGAAGTCA AGG (reversed) Intergenic
No off target data available for this crispr