ID: 1185845185

View in Genome Browser
Species Human (GRCh38)
Location X:3431124-3431146
Sequence TCTCCCCTGAGAGACAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185845185_1185845191 15 Left 1185845185 X:3431124-3431146 CCCTGCTTGTCTCTCAGGGGAGA No data
Right 1185845191 X:3431162-3431184 CCAAAGAAAACAGCCTTGGTAGG No data
1185845185_1185845188 11 Left 1185845185 X:3431124-3431146 CCCTGCTTGTCTCTCAGGGGAGA No data
Right 1185845188 X:3431158-3431180 ACCGCCAAAGAAAACAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185845185 Original CRISPR TCTCCCCTGAGAGACAAGCA GGG (reversed) Intergenic
No off target data available for this crispr