ID: 1185845186

View in Genome Browser
Species Human (GRCh38)
Location X:3431125-3431147
Sequence TTCTCCCCTGAGAGACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185845186_1185845191 14 Left 1185845186 X:3431125-3431147 CCTGCTTGTCTCTCAGGGGAGAA No data
Right 1185845191 X:3431162-3431184 CCAAAGAAAACAGCCTTGGTAGG No data
1185845186_1185845188 10 Left 1185845186 X:3431125-3431147 CCTGCTTGTCTCTCAGGGGAGAA No data
Right 1185845188 X:3431158-3431180 ACCGCCAAAGAAAACAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185845186 Original CRISPR TTCTCCCCTGAGAGACAAGC AGG (reversed) Intergenic