ID: 1185845191

View in Genome Browser
Species Human (GRCh38)
Location X:3431162-3431184
Sequence CCAAAGAAAACAGCCTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185845186_1185845191 14 Left 1185845186 X:3431125-3431147 CCTGCTTGTCTCTCAGGGGAGAA No data
Right 1185845191 X:3431162-3431184 CCAAAGAAAACAGCCTTGGTAGG No data
1185845181_1185845191 29 Left 1185845181 X:3431110-3431132 CCTTGACTTCTTGGCCCTGCTTG No data
Right 1185845191 X:3431162-3431184 CCAAAGAAAACAGCCTTGGTAGG No data
1185845185_1185845191 15 Left 1185845185 X:3431124-3431146 CCCTGCTTGTCTCTCAGGGGAGA No data
Right 1185845191 X:3431162-3431184 CCAAAGAAAACAGCCTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185845191 Original CRISPR CCAAAGAAAACAGCCTTGGT AGG Intergenic
No off target data available for this crispr