ID: 1185848183

View in Genome Browser
Species Human (GRCh38)
Location X:3459766-3459788
Sequence CCCTAGCAATTGCTCTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185848183_1185848189 10 Left 1185848183 X:3459766-3459788 CCTTTAGAGAGCAATTGCTAGGG No data
Right 1185848189 X:3459799-3459821 GAAAAGTTCAGTGACTCCAACGG No data
1185848183_1185848190 18 Left 1185848183 X:3459766-3459788 CCTTTAGAGAGCAATTGCTAGGG No data
Right 1185848190 X:3459807-3459829 CAGTGACTCCAACGGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185848183 Original CRISPR CCCTAGCAATTGCTCTCTAA AGG (reversed) Intergenic
No off target data available for this crispr