ID: 1185848183 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:3459766-3459788 |
| Sequence | CCCTAGCAATTGCTCTCTAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185848183_1185848189 | 10 | Left | 1185848183 | X:3459766-3459788 | CCTTTAGAGAGCAATTGCTAGGG | No data | ||
| Right | 1185848189 | X:3459799-3459821 | GAAAAGTTCAGTGACTCCAACGG | No data | ||||
| 1185848183_1185848190 | 18 | Left | 1185848183 | X:3459766-3459788 | CCTTTAGAGAGCAATTGCTAGGG | No data | ||
| Right | 1185848190 | X:3459807-3459829 | CAGTGACTCCAACGGCAAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185848183 | Original CRISPR | CCCTAGCAATTGCTCTCTAA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||