ID: 1185848188

View in Genome Browser
Species Human (GRCh38)
Location X:3459790-3459812
Sequence TCACTGAACTTTTCTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185848188_1185848190 -6 Left 1185848188 X:3459790-3459812 CCAGGGAAAGAAAAGTTCAGTGA No data
Right 1185848190 X:3459807-3459829 CAGTGACTCCAACGGCAAGTAGG No data
1185848188_1185848193 15 Left 1185848188 X:3459790-3459812 CCAGGGAAAGAAAAGTTCAGTGA No data
Right 1185848193 X:3459828-3459850 GGATTAGAACAAATTCCTCTGGG No data
1185848188_1185848192 14 Left 1185848188 X:3459790-3459812 CCAGGGAAAGAAAAGTTCAGTGA No data
Right 1185848192 X:3459827-3459849 AGGATTAGAACAAATTCCTCTGG No data
1185848188_1185848194 21 Left 1185848188 X:3459790-3459812 CCAGGGAAAGAAAAGTTCAGTGA No data
Right 1185848194 X:3459834-3459856 GAACAAATTCCTCTGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185848188 Original CRISPR TCACTGAACTTTTCTTTCCC TGG (reversed) Intergenic
No off target data available for this crispr