ID: 1185848190

View in Genome Browser
Species Human (GRCh38)
Location X:3459807-3459829
Sequence CAGTGACTCCAACGGCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185848188_1185848190 -6 Left 1185848188 X:3459790-3459812 CCAGGGAAAGAAAAGTTCAGTGA No data
Right 1185848190 X:3459807-3459829 CAGTGACTCCAACGGCAAGTAGG No data
1185848183_1185848190 18 Left 1185848183 X:3459766-3459788 CCTTTAGAGAGCAATTGCTAGGG No data
Right 1185848190 X:3459807-3459829 CAGTGACTCCAACGGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185848190 Original CRISPR CAGTGACTCCAACGGCAAGT AGG Intergenic
No off target data available for this crispr