ID: 1185853529

View in Genome Browser
Species Human (GRCh38)
Location X:3510977-3510999
Sequence GGTCCTACCATTTTAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185853529_1185853535 25 Left 1185853529 X:3510977-3510999 CCTTCCTTTAAAATGGTAGGACC No data
Right 1185853535 X:3511025-3511047 TCTCGTGTGTATTTTTCTCAGGG No data
1185853529_1185853534 24 Left 1185853529 X:3510977-3510999 CCTTCCTTTAAAATGGTAGGACC No data
Right 1185853534 X:3511024-3511046 CTCTCGTGTGTATTTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185853529 Original CRISPR GGTCCTACCATTTTAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr