ID: 1185855626

View in Genome Browser
Species Human (GRCh38)
Location X:3532215-3532237
Sequence GTAGAGTGGCATCCAGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185855626_1185855634 9 Left 1185855626 X:3532215-3532237 CCACCAACTGGATGCCACTCTAC No data
Right 1185855634 X:3532247-3532269 GGAAATAAAATGAGCTTCTTAGG No data
1185855626_1185855635 23 Left 1185855626 X:3532215-3532237 CCACCAACTGGATGCCACTCTAC No data
Right 1185855635 X:3532261-3532283 CTTCTTAGGACAAATCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185855626 Original CRISPR GTAGAGTGGCATCCAGTTGG TGG (reversed) Intergenic