ID: 1185855634

View in Genome Browser
Species Human (GRCh38)
Location X:3532247-3532269
Sequence GGAAATAAAATGAGCTTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185855631_1185855634 -5 Left 1185855631 X:3532229-3532251 CCACTCTACCCAGGTCAGGGAAA No data
Right 1185855634 X:3532247-3532269 GGAAATAAAATGAGCTTCTTAGG No data
1185855627_1185855634 6 Left 1185855627 X:3532218-3532240 CCAACTGGATGCCACTCTACCCA No data
Right 1185855634 X:3532247-3532269 GGAAATAAAATGAGCTTCTTAGG No data
1185855626_1185855634 9 Left 1185855626 X:3532215-3532237 CCACCAACTGGATGCCACTCTAC No data
Right 1185855634 X:3532247-3532269 GGAAATAAAATGAGCTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185855634 Original CRISPR GGAAATAAAATGAGCTTCTT AGG Intergenic