ID: 1185855635

View in Genome Browser
Species Human (GRCh38)
Location X:3532261-3532283
Sequence CTTCTTAGGACAAATCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185855632_1185855635 1 Left 1185855632 X:3532237-3532259 CCCAGGTCAGGGAAATAAAATGA No data
Right 1185855635 X:3532261-3532283 CTTCTTAGGACAAATCAGAAAGG No data
1185855631_1185855635 9 Left 1185855631 X:3532229-3532251 CCACTCTACCCAGGTCAGGGAAA No data
Right 1185855635 X:3532261-3532283 CTTCTTAGGACAAATCAGAAAGG No data
1185855633_1185855635 0 Left 1185855633 X:3532238-3532260 CCAGGTCAGGGAAATAAAATGAG No data
Right 1185855635 X:3532261-3532283 CTTCTTAGGACAAATCAGAAAGG No data
1185855627_1185855635 20 Left 1185855627 X:3532218-3532240 CCAACTGGATGCCACTCTACCCA No data
Right 1185855635 X:3532261-3532283 CTTCTTAGGACAAATCAGAAAGG No data
1185855626_1185855635 23 Left 1185855626 X:3532215-3532237 CCACCAACTGGATGCCACTCTAC No data
Right 1185855635 X:3532261-3532283 CTTCTTAGGACAAATCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185855635 Original CRISPR CTTCTTAGGACAAATCAGAA AGG Intergenic