ID: 1185866618

View in Genome Browser
Species Human (GRCh38)
Location X:3629950-3629972
Sequence GGTCTCCAGGGGTCAAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185866618_1185866624 20 Left 1185866618 X:3629950-3629972 CCATTTCTTGACCCCTGGAGACC 0: 1
1: 0
2: 0
3: 22
4: 197
Right 1185866624 X:3629993-3630015 TGCAAATACAGCCTTGAAAATGG 0: 1
1: 1
2: 2
3: 31
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185866618 Original CRISPR GGTCTCCAGGGGTCAAGAAA TGG (reversed) Intronic
900565736 1:3331068-3331090 GGGCTCCAGGGGCCAAGGGAGGG + Intronic
900604766 1:3519059-3519081 GGCCACCAGGCGTCCAGAAATGG + Intronic
900793015 1:4691943-4691965 GGTCTCCAGGGCTCAGAAGAGGG + Intronic
902251548 1:15156837-15156859 GGTCTCCTGGGTTAAAGTAAAGG - Intronic
902701006 1:18171993-18172015 CCTGTCCAGGGGACAAGAAAAGG - Intronic
902715318 1:18268768-18268790 GGTCTCCAGGGTTGGAGAAAGGG + Intronic
902874427 1:19332288-19332310 GGTCTCATGGGATGAAGAAACGG - Intergenic
902982146 1:20132051-20132073 GGTTTCCAGGGGCTGAGAAAAGG - Intergenic
903668922 1:25024220-25024242 GTTCTCCAGGGGGCATCAAAGGG - Intergenic
904427134 1:30435785-30435807 GGTCTCAAGGTGCCACGAAAAGG + Intergenic
906813967 1:48858657-48858679 GGTTGCCAGGGGTCAGGAAAAGG + Intronic
907126810 1:52057337-52057359 GTTCTCAAGGACTCAAGAAAGGG - Intronic
907659995 1:56383155-56383177 GATCTCCAGGGAGCAAGAAAGGG - Intergenic
909191870 1:72563184-72563206 AGTTGCCAGGGGTCAAAAAATGG + Intergenic
914676281 1:149909566-149909588 GGTTACCTGGGGTCAAGAGAAGG + Exonic
916728596 1:167546000-167546022 GGTGTCCAGGGCACATGAAACGG + Intronic
918587765 1:186207408-186207430 GTTATCCAGGCGGCAAGAAAGGG + Intergenic
919882095 1:201907560-201907582 GGTCTCCAGGGCTTAATACATGG - Intronic
920380433 1:205531798-205531820 GGGCTCCAAGGGGCCAGAAAGGG - Intronic
921191592 1:212713721-212713743 GGTCACCAGGGGTAAAGGAGCGG - Intergenic
921794328 1:219325448-219325470 GGTCTTCATGAGTCAAGAAAGGG - Intergenic
922789123 1:228300353-228300375 GGTCCCCAGGTGTCAGGACAGGG + Intronic
923940737 1:238822889-238822911 GGTCTCCAGGGGTTGAGGGAAGG + Intergenic
1063718928 10:8558756-8558778 GATCTGCAGGGGTAGAGAAAGGG - Intergenic
1067132138 10:43574482-43574504 GGCGTTCAGGGGTCAGGAAATGG - Intronic
1067409004 10:46048423-46048445 GCTCCCCAGGGGTTGAGAAAGGG + Intergenic
1068522426 10:58092874-58092896 GGTCTCCAGGGGTTATGAATGGG + Intergenic
1068926336 10:62543244-62543266 GGTTACCAGGGGTGAGGAAAGGG + Intronic
1069105346 10:64376820-64376842 TGTCTCCAATGGTCTAGAAAAGG + Intergenic
1069682155 10:70292781-70292803 GGTGTCCAGGGCCCAAGAAATGG - Intergenic
1074888215 10:117711639-117711661 GGTCTCCCGGAGTGAAGAAAGGG - Intergenic
1077183776 11:1227616-1227638 GGGCTCCTGGGGACAAGATATGG - Intronic
1077725275 11:4668288-4668310 GGTTTTCAGGGGTTAAGAAGGGG - Intergenic
1079495411 11:21037739-21037761 AGTTTGCAGGGGTCAAAAAAAGG - Intronic
1079781706 11:24615318-24615340 GGTTGCCAGGGATCAAGAACTGG - Intronic
1081492391 11:43578775-43578797 GGTGTCCAAGAGTCAAGAAGGGG + Intronic
1081739620 11:45429396-45429418 AGGCTTCAGTGGTCAAGAAAGGG + Intergenic
1083569799 11:63753236-63753258 GGTCTCTATGGGTCAAGACTGGG - Intronic
1086338219 11:85821344-85821366 GGACTCCAGGAGTCAAAAAAGGG + Intergenic
1089383419 11:118052281-118052303 GGACTCCAGGGGACAAAAGAAGG + Intergenic
1090450211 11:126799716-126799738 GGTTTCCAGGGAGGAAGAAAAGG - Intronic
1094188572 12:27672191-27672213 GGTCTGAAGGGGACAGGAAAAGG + Intronic
1096186835 12:49587114-49587136 GGACTCCAGGGGCCAACAAGAGG - Intronic
1100894419 12:99163634-99163656 AGTTGCCAGGGGTCAAAAAATGG - Intronic
1103236865 12:119380380-119380402 GCTCTCCAGGGGAGAAGGAAAGG - Intronic
1104070715 12:125343041-125343063 GTTCTCCAGGGTACAATAAAGGG + Intronic
1105070313 12:133230519-133230541 GCTCTCCACTGGTCAGGAAAGGG - Intronic
1105759183 13:23497861-23497883 GGTCTTCAGGGGGCAAGATTAGG - Intergenic
1107572684 13:41679867-41679889 TGTCTCTAGGGGGCAGGAAATGG - Intronic
1110157616 13:72337482-72337504 GGTTTCCAGGGGTTAGGAATGGG + Intergenic
1112783564 13:102927759-102927781 GGGTTCCAGGGTTCAAGGAAGGG - Intergenic
1119447846 14:74681459-74681481 GGTTGCCAGGGGTTAAGAACAGG + Intronic
1120009688 14:79399527-79399549 TGACTCCAGGGGTCTACAAACGG + Intronic
1120288220 14:82532904-82532926 TGTCTACAGGGAACAAGAAATGG - Intergenic
1122369813 14:101223284-101223306 GGTCTCTAGAGGGCAAGAGAGGG + Intergenic
1124174671 15:27412349-27412371 GATTTCCAGGGGTCAAGGACAGG - Intronic
1124686908 15:31790714-31790736 GGTCTTCAGGGCACAAGAGATGG - Intronic
1125987890 15:44073259-44073281 TGTCTGGAAGGGTCAAGAAAAGG - Intronic
1129157544 15:73728189-73728211 AGTCTCCAGGGCTCAACAATGGG + Intergenic
1129206235 15:74038591-74038613 GGGCACCAGGGGTCTGGAAAGGG - Intronic
1129334609 15:74844556-74844578 GGTCTCCAGGCTTCCAGAGAAGG - Exonic
1130104609 15:80920074-80920096 GATCTGCAGGGGTCAAGACAGGG - Exonic
1133042693 16:3068889-3068911 CGTCTCCCAGGGTCAGGAAAAGG + Intronic
1133044736 16:3081532-3081554 CGTCTCCCAGGGTCAGGAAAAGG + Intronic
1134599406 16:15521655-15521677 GGAAACCAGGGGTCAAGCAAAGG - Intronic
1135398940 16:22152367-22152389 GGTCTCCATGGGACAAGCCACGG + Intronic
1140444346 16:75012897-75012919 GGTCTCCAGAGCTCAATAAAGGG + Intronic
1140880347 16:79192541-79192563 GGTCTCTATTGGTCAAGGAAAGG + Intronic
1141090462 16:81126840-81126862 GGTCTCCTGGGGTTAAGGAAAGG - Intergenic
1142278736 16:89137107-89137129 GGCATCCAGGGGTCAGGAGAGGG + Intronic
1142748705 17:1974603-1974625 GGTCTGAAAGGGTAAAGAAAGGG + Intronic
1143060287 17:4194921-4194943 GGTCTGCAGGCGCCAGGAAATGG - Intronic
1143334824 17:6164386-6164408 TGACACCAGGAGTCAAGAAATGG + Intergenic
1143521313 17:7445738-7445760 GGTGCTCAGGGGTCAATAAATGG + Intronic
1149264611 17:54913882-54913904 AGTCTCCATGGGTCAAAGAAAGG - Intronic
1149691032 17:58576686-58576708 GGTTGCCAGGGGTTAAGGAAGGG - Intronic
1150614425 17:66758073-66758095 GATCTCCATGGGGCAAGGAAGGG + Intronic
1151517991 17:74609078-74609100 GGTTTCCAGGGGACAGGAATGGG + Intergenic
1155090090 18:22499889-22499911 GGTTTCCAGGGGTTAAGGAGTGG + Intergenic
1155652041 18:28154055-28154077 GGTTTCCAGAGGTAAAGATAAGG - Intronic
1156794825 18:41031339-41031361 AGTCTTCAGGGATCAAGAGAAGG - Intergenic
1157607577 18:48935529-48935551 GGTCTCCAGGGGCCCAGGAAGGG + Intronic
1158973199 18:62687346-62687368 GTCCTCCAGGAGCCAAGAAAGGG - Intergenic
1161399896 19:4062608-4062630 GGTATCCGGGGGCCAGGAAAGGG - Intronic
1161924163 19:7288873-7288895 CGTCTCCTGGGTTCAAGCAATGG - Intronic
1162055734 19:8062785-8062807 GCTCTCCAGGGGCCAAGCATTGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1163804475 19:19387170-19387192 GTTCCCCAGGGGTCCACAAAAGG - Intronic
1164414589 19:28035999-28036021 GGTTTCCAGGGGTCAGGGACTGG + Intergenic
1165279803 19:34786280-34786302 GGTGTGGAGGGGTCAATAAATGG - Intergenic
1166104002 19:40588817-40588839 GGTCAACAGGGGTCAGGTAAGGG - Intronic
1166934181 19:46321127-46321149 GGTCCCCAGAGGTTAAGACAAGG - Intronic
1168074068 19:53969639-53969661 GGGCTCCAGGGGTGTAGAAACGG + Intronic
1168081577 19:54014094-54014116 GGTTGCCAGGTGTTAAGAAAAGG + Intergenic
1168089967 19:54075971-54075993 GATCTCCAGGGGTCAGGGCAGGG - Intronic
1168281812 19:55309954-55309976 GGGGTCCAGGGGTCCAGGAAGGG - Intronic
1168682956 19:58329206-58329228 GGTCACCAGCGGTCACCAAAAGG + Intronic
926158599 2:10472507-10472529 GGCTTCCAGGGGACATGAAAGGG - Intergenic
929328708 2:40651704-40651726 GGTCTCTTGAGGTCAAGAATTGG + Intergenic
930104514 2:47629540-47629562 GGTCGCCAGGTATCAAGGAAAGG + Intergenic
936757570 2:115733385-115733407 AGTCTCCAGAGGTCAAACAAGGG + Intronic
937154416 2:119708801-119708823 AGTCTCTAGGGGTCCAGAGAAGG - Intergenic
938099659 2:128490053-128490075 GGCCTGCAGGAGCCAAGAAATGG + Intergenic
943287897 2:186028073-186028095 GGTTGCCAGGGGTCAAGGGAAGG + Intergenic
944816272 2:203379229-203379251 GGTCTTTTGGGGTCAAAAAATGG + Intronic
947531530 2:230911776-230911798 GGTCTCCACAGGGCAAGGAAAGG + Intronic
947583194 2:231334556-231334578 AGTTTCCAGGGGTCAGGACATGG + Intronic
948346938 2:237306532-237306554 GGTAACCAGGGGTAAAGAAATGG - Intergenic
948683251 2:239652243-239652265 GGTTTCCAGGGGTCAGGGATGGG + Intergenic
1168802062 20:650066-650088 GGACTCCAGGGCTCCAGGAATGG + Intronic
1169613215 20:7407580-7407602 AGCCTCCATGGGTCAAGAGAAGG - Intergenic
1170627339 20:18039926-18039948 GGTCTCAAGGGGAAAAAAAAAGG - Intronic
1170728076 20:18947778-18947800 AATCTCCAGGGATCAAGGAAGGG + Intergenic
1172419904 20:34807385-34807407 GGTTTCCATGGGTCAGGAATCGG - Intronic
1172997549 20:39082505-39082527 GCTCTCCAGGGCTCCAGGAAGGG - Intergenic
1175182783 20:57160390-57160412 GGTCTCCAGGAGGCAGGACAGGG + Intergenic
1178681415 21:34675418-34675440 GGTCTCCAGGGAGCTTGAAAGGG + Intronic
1181087481 22:20448078-20448100 GGTTTCCAGGGCTTAAGGAAGGG - Intronic
1182014457 22:27027253-27027275 GGCCTCCAGGGAGAAAGAAAGGG + Intergenic
1182073828 22:27481224-27481246 GGTCCCAGGAGGTCAAGAAATGG + Intergenic
1185211760 22:49574472-49574494 GGACTCCAGGGGCCAGGAAGAGG - Intronic
949469996 3:4384487-4384509 GTTTTCCAGGGGTTAAGAAGGGG - Intronic
949746141 3:7294339-7294361 GGACTCCTGGGGAGAAGAAATGG - Intronic
950222238 3:11205297-11205319 GGACTCCAGGGGTCCAGAGCTGG - Intronic
952948055 3:38494394-38494416 GGTCCCAAGAGGTCAAGAACTGG - Intergenic
954002842 3:47571439-47571461 GGTATCCAGGGGGCAGGAGATGG - Intronic
954325601 3:49861689-49861711 GGACGCCAAGGGTCCAGAAAGGG + Intronic
960525108 3:118700939-118700961 GGTCCCCAAGTGTCAAGGAATGG - Intergenic
965060498 3:163779442-163779464 GGTCACCAGGGAACAGGAAATGG + Intergenic
965464741 3:169013906-169013928 GGGCTCTAGGGGTCTAGTAAGGG - Intergenic
967304794 3:188050010-188050032 GGCCTCCAGTGCTCAGGAAAGGG + Intergenic
967935754 3:194726107-194726129 GGGCAGCAGGGGTTAAGAAAGGG - Intergenic
967951530 3:194844768-194844790 GGTATACTGGGGTCATGAAAGGG + Intergenic
971236911 4:24850555-24850577 GTGCTCCAGGGCTCAAGTAAGGG + Intronic
972254028 4:37334481-37334503 GGTGGCTAGGGGTGAAGAAAGGG - Intronic
972643305 4:40944908-40944930 GATCTCCAGGGTTCTAGGAAAGG - Exonic
972704641 4:41530320-41530342 GGTGTCTAGCTGTCAAGAAAAGG + Intronic
975425907 4:74227286-74227308 GGTCTGTAGGGGTGAGGAAATGG - Intronic
975663289 4:76708514-76708536 GGTCTAAAGGGGTCCTGAAAAGG + Intronic
976014030 4:80528223-80528245 GGTCTCATGGGCTCAAAAAAGGG - Intronic
978975663 4:114867385-114867407 CGTCTCCAGGGTTAAAGAAGTGG - Intronic
980906747 4:138955666-138955688 GGCTTCCAGGGGCCGAGAAAGGG - Intergenic
981858820 4:149329379-149329401 GGTTCCCAGGGGTTAAGGAAAGG - Intergenic
982060424 4:151599054-151599076 GGTCTCCAGGGTTTGAGATAAGG + Intronic
982617293 4:157655237-157655259 AGTTTCCAGGGTTCCAGAAATGG + Intergenic
984742876 4:183184142-183184164 GGTTGCCAGGGGACAAGGAAAGG - Intronic
985017391 4:185650948-185650970 GGTCTCCAGGGGTGCAGAACAGG + Intronic
986412221 5:7492511-7492533 GGACTGTAGGAGTCAAGAAAGGG + Intronic
988952312 5:36275825-36275847 TGTCTCTGGGGATCAAGAAAAGG + Intronic
992219468 5:74557580-74557602 GGTTTCCTGGCCTCAAGAAAGGG - Intergenic
992645505 5:78807707-78807729 GGTAACCAGGGGTGAGGAAAAGG + Intronic
995036280 5:107537964-107537986 GTCCTCCAGGGCTGAAGAAAAGG + Intronic
995658377 5:114452643-114452665 GGTCTCCGGGGGTGAAGCCATGG - Intronic
995936038 5:117515665-117515687 TGTCTCCAGGTGTCTAGAAAAGG + Intergenic
996222819 5:120953822-120953844 GGTGTACAGAAGTCAAGAAACGG + Intergenic
997472023 5:134122504-134122526 GGTCTCCAGAGACCCAGAAAGGG - Intronic
998891287 5:146748594-146748616 GGTCACCTGGGGTTAAGAAGAGG + Intronic
999674107 5:153981906-153981928 GGTCCCCAGGAGTCAAGATAGGG - Intergenic
1001760957 5:174207695-174207717 GGATTTCAGGGGGCAAGAAATGG - Intronic
1003041599 6:2693051-2693073 GGTCTCCAGAGATCTATAAATGG + Intronic
1004035657 6:11920517-11920539 GGACTCCAGGCATCAAGAACAGG - Intergenic
1004518452 6:16340465-16340487 GGTCTAGAGGGGTCCAGACATGG - Intronic
1006889283 6:37411322-37411344 GGTTTCCAGAGGCCAAGAAGGGG - Intergenic
1007376658 6:41461558-41461580 GGTCTCTAAGGGACAAGAAGCGG + Intergenic
1008586404 6:52954397-52954419 GGTATACAGAGGTCAAAAAAAGG + Intergenic
1008726211 6:54423919-54423941 GGTTTCCAGGAGTCAAGTGATGG + Intergenic
1008902944 6:56643730-56643752 TCTTTTCAGGGGTCAAGAAAGGG + Intronic
1009703225 6:67210836-67210858 CGTCTCCAGGGGACAAGAGCAGG - Intergenic
1011249874 6:85359837-85359859 TGTTTCCAGGGGAGAAGAAAAGG - Intergenic
1011640859 6:89414489-89414511 GGACTCAAGGGATCAGGAAAGGG + Intergenic
1013415502 6:109920955-109920977 GGAATCCAGGGGCAAAGAAAGGG - Intergenic
1015745700 6:136507290-136507312 GGCCTCCAGGAGTCCAGAGAGGG - Intronic
1016564215 6:145434776-145434798 GGTTGCCAGGGGACAGGAAAAGG - Intergenic
1018091460 6:160349282-160349304 GGTCTCCAGGGTCAAAGGAAAGG + Intronic
1020013679 7:4819372-4819394 CGTCTCCGGGGGTTTAGAAATGG - Intronic
1020927335 7:14347599-14347621 GGTTATCAGGGGTCAAGAATTGG + Intronic
1021924941 7:25525366-25525388 GGTCCCTAGGGGTTAAGGAAAGG + Intergenic
1023075801 7:36481892-36481914 TGTCTCCTGGGTTCAAGCAAGGG + Intergenic
1024502608 7:50128294-50128316 GGTTACCAGAGGCCAAGAAAGGG + Intronic
1024510747 7:50202876-50202898 AGACTCCAGGGATCAGGAAATGG + Intergenic
1025167268 7:56723368-56723390 GGTCTTCAGGGGAGAAGAGAAGG + Intergenic
1026555830 7:71407893-71407915 GGTCACCAGGGGTTGGGAAAGGG + Intronic
1028922118 7:96321127-96321149 GGTGTCCAGGTTTCAAGAAATGG + Intronic
1030271994 7:107678424-107678446 GTTCTGCAGGGGTCCTGAAATGG - Intronic
1031920360 7:127595750-127595772 GGTCTACATGGGACAAGAAGTGG - Exonic
1032458960 7:132095194-132095216 GGTCTCCAGGGATGAAAACAAGG - Intergenic
1032728685 7:134616162-134616184 GAGCTCCCTGGGTCAAGAAAAGG + Intergenic
1036719885 8:11164331-11164353 GGACCCCAGGGGTGGAGAAAAGG - Intronic
1036729313 8:11248396-11248418 GGTCTCCAGGGGTGCAGGAGTGG - Intergenic
1037606517 8:20442290-20442312 GGTTTCCAGATATCAAGAAATGG + Intergenic
1039633120 8:39134151-39134173 GGGCTCCAGGGCTGAGGAAATGG + Intronic
1041467469 8:58171322-58171344 GGTGTCCAGGGATGAAGGAATGG - Intronic
1042792804 8:72627271-72627293 GGTCACTAGGAGTGAAGAAAAGG + Intronic
1043708298 8:83380407-83380429 AGTCTCCAGGGATCAGGAATGGG - Intergenic
1043956719 8:86368818-86368840 AGCCTTCAGGGATCAAGAAAGGG - Intronic
1047185394 8:122628479-122628501 AGTCTCCAGGTGACAGGAAATGG + Intergenic
1048614318 8:136057705-136057727 GGTTTCCAGGGGCAGAGAAAAGG + Intergenic
1051355898 9:16239656-16239678 GGGTTCCAGGGGGCTAGAAAGGG - Intronic
1055253141 9:74332739-74332761 GGGGTCTAGGGGTAAAGAAAGGG - Intergenic
1057625422 9:96672075-96672097 GGTTTCCAGGGGTAAAGAAGGGG + Intergenic
1058060692 9:100492730-100492752 GCTCTAGAAGGGTCAAGAAAAGG + Intronic
1058910751 9:109518016-109518038 GGCCTGCAGGGGAAAAGAAAGGG - Intergenic
1059282114 9:113143955-113143977 TGTCTCCAGGCATGAAGAAATGG + Intergenic
1060733217 9:126050721-126050743 GGTCTCCAGGGGTCCACAGAAGG - Intergenic
1060770824 9:126330764-126330786 GGTTGCCAGGGGTCAGGAAAGGG - Intronic
1061054826 9:128216913-128216935 GATCTCCAGGGCCCAGGAAAGGG - Intronic
1062234685 9:135502219-135502241 GGACTCCACGGGTTCAGAAATGG + Intronic
1185520059 X:731925-731947 GGTCACCAGGGGTTCAGAAGTGG - Intergenic
1185866618 X:3629950-3629972 GGTCTCCAGGGGTCAAGAAATGG - Intronic
1194543813 X:95206601-95206623 TGTCTCCAGTGGTGAAGCAATGG - Intergenic
1195296860 X:103487084-103487106 GGTTTCCAGGGCTTGAGAAATGG + Intergenic
1196682123 X:118479969-118479991 GGTTGCCAGGGGTCAGGAAGAGG - Intergenic
1196790362 X:119458906-119458928 GGTTTCCAGGTGCCAAGAAATGG + Intergenic
1197187326 X:123602557-123602579 GGTTTCCAGGGGCCGAGGAAGGG + Intronic
1199439449 X:147852131-147852153 GGTTACCAGGGGTACAGAAAGGG - Intergenic
1199606381 X:149582915-149582937 GGGCTCCAGCAGTCAAGAAGAGG - Exonic
1199632741 X:149786453-149786475 GGGCTCCAGCAGTCAAGAAGAGG + Exonic
1199750556 X:150813050-150813072 GGTTGCCAGGGGTTAGGAAAGGG + Intronic
1199948110 X:152683281-152683303 GGGCTCCAGCAGCCAAGAAAAGG + Intergenic
1199961569 X:152785173-152785195 GGGCTCCAGCAGCCAAGAAAAGG - Intergenic