ID: 1185867401

View in Genome Browser
Species Human (GRCh38)
Location X:3636255-3636277
Sequence GTGCAGACACAGGCTGCGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185867394_1185867401 22 Left 1185867394 X:3636210-3636232 CCTGCTAAGAGTGGGAATCCAGC 0: 2
1: 0
2: 1
3: 7
4: 76
Right 1185867401 X:3636255-3636277 GTGCAGACACAGGCTGCGAAGGG 0: 1
1: 1
2: 0
3: 12
4: 184
1185867396_1185867401 4 Left 1185867396 X:3636228-3636250 CCAGCAAATGGAGCTGCGATAGG 0: 1
1: 1
2: 0
3: 8
4: 66
Right 1185867401 X:3636255-3636277 GTGCAGACACAGGCTGCGAAGGG 0: 1
1: 1
2: 0
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185867401 Original CRISPR GTGCAGACACAGGCTGCGAA GGG Intronic
900313844 1:2047620-2047642 GGACAGACACAGGTTCCGAAAGG - Intergenic
901206036 1:7496450-7496472 GTGCACACGCAGGCTGTGACAGG - Intronic
903143684 1:21356038-21356060 GTACAGACACAGGCTCCAAGCGG - Intergenic
907524861 1:55048198-55048220 GTGAAGACAGAGGCTGGGATTGG - Intronic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
908238506 1:62169778-62169800 GTGCAGACTCAGTCTGAGACTGG - Intergenic
908414991 1:63904454-63904476 GTCCAGACACAAGCTGGCAAAGG - Intronic
910394900 1:86782448-86782470 GTGCTGAAACAGGCTGGGCATGG + Intergenic
914250328 1:145917138-145917160 GAGCAGAAACAGGCTGGGCATGG + Intronic
914907231 1:151756603-151756625 GTGCAGTCATAGTCTGAGAAGGG + Intergenic
915130208 1:153690441-153690463 GTGCAGGCACAGGCTGCCCCAGG - Intronic
916517995 1:165537988-165538010 GTGCAGAAACAGGCTACGATGGG - Intergenic
918000083 1:180485506-180485528 GTGAAGACAAAGGCTAAGAATGG + Intronic
918820492 1:189249438-189249460 GTGAAGACACTGGCTGCGGCGGG + Intergenic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
920919020 1:210282698-210282720 GTGAAGCCACATGCTGAGAATGG + Intergenic
921290875 1:213656236-213656258 GTGCTGCCACAGGCTGAGATTGG - Intergenic
922162610 1:223089466-223089488 GTGCAGCCAAAAGCTGTGAAGGG - Intergenic
922343016 1:224672602-224672624 GTGAAGACAGAGGCTGCAATTGG - Intronic
922740376 1:228011001-228011023 GTGCAGACACTGGCTGAGCAGGG - Intronic
923072497 1:230578304-230578326 GTACAGAAACAGGGTGCAAAAGG - Intergenic
1063340805 10:5261716-5261738 GTGCAGACACAGGGAGAAAAGGG + Intergenic
1068300512 10:55132137-55132159 GTGAAGACACAGGCTGCATCAGG - Intronic
1069771546 10:70903644-70903666 CTGCGGACACAGGCTGCAAGGGG - Intergenic
1075259365 10:120949445-120949467 CTGCAGACACAGGGTGTGCAAGG - Intergenic
1076100527 10:127774155-127774177 GTCCAGAGACAGGCTGTGCAGGG - Intergenic
1076173021 10:128338772-128338794 ATACAGAGACAGGCTGCGAATGG + Intergenic
1076216117 10:128694739-128694761 GGGCAGACGCAGGCAGCGAGGGG - Intergenic
1076859302 10:133133048-133133070 GTGCAGAGACTGGCTGCAACGGG + Intergenic
1077052664 11:574802-574824 GTGCACACACAGGCGGGGGAGGG - Intergenic
1077223288 11:1426771-1426793 GTGCAGACACAGGATGTGGCGGG + Intronic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1084835518 11:71799314-71799336 GGGCAGACACAGGCAGAGAGTGG + Intronic
1085193581 11:74650902-74650924 GTGCACACACAGGCAGCTGAGGG + Intronic
1088191039 11:107228427-107228449 GTGAAGAGATAGGCTGAGAAGGG - Intergenic
1088338297 11:108733526-108733548 GTTCAGACACAGGCTTTGACAGG + Intronic
1088889765 11:114035384-114035406 GTGCAGACTCAGGAGGCGAAGGG - Intergenic
1089131024 11:116212073-116212095 ATGCAGACATAGGCTGCCTACGG - Intergenic
1092407767 12:8232832-8232854 GGGCAGACACAGGCAGAGAGTGG - Intergenic
1096750459 12:53755732-53755754 GTGCAGCCAAAGGCTGGGATGGG - Intergenic
1102943082 12:116961287-116961309 GTGCAGATACAGGCCGGGCACGG - Intronic
1107888927 13:44897021-44897043 GTGAAGACACAGGCAGAGATTGG - Intergenic
1108027389 13:46192266-46192288 GTGCAGAGACAGGCAGCGAGAGG + Intronic
1109720580 13:66270423-66270445 GTGCAGTAACAGGCTGTGAAGGG + Intergenic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1113652219 13:112042082-112042104 GTGCAGACAGAGGCTGAGGCCGG + Intergenic
1117486725 14:56205079-56205101 TAGCAGACTCAGGCTGCGAGAGG + Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118767596 14:68920628-68920650 GTGCAGACACAGGCTGGTGGAGG - Intronic
1119348390 14:73944590-73944612 GTGCAGGCACAGGCTGTGCCCGG + Exonic
1121028114 14:90631694-90631716 GTGCAGACTCAGGCTGGGCAGGG - Intronic
1121611886 14:95286916-95286938 AGGCAGACCCAGGCTGTGAAAGG + Intronic
1121693002 14:95891294-95891316 CTGAAGACACAGGCTGCCAGCGG + Intergenic
1122017219 14:98806304-98806326 GTGCAGACACAGTTTGCACATGG - Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1127462580 15:59212857-59212879 GTGAAGACACAGGCAGAGACTGG + Intronic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1131070284 15:89461579-89461601 GTTCAGGCACAGGCTGCCCAGGG + Intergenic
1132640821 16:977569-977591 GTGCACACACCGGCTGCCAGCGG + Intronic
1132722942 16:1325919-1325941 TTCCAGACACAGGCTGCCCAGGG - Exonic
1132873520 16:2125835-2125857 CTGCCCACACAGGCTGTGAAGGG - Intronic
1133348485 16:5085960-5085982 GGGCAGACACAGGCAGAGAGTGG - Intronic
1134044959 16:11094171-11094193 GGACAGCCACAGGCTGGGAAGGG - Intronic
1134608533 16:15589906-15589928 GTGAAAACTCAGGCTGCAAAGGG + Intronic
1134886300 16:17795739-17795761 AAGCAGACACAGGCTGGGCACGG + Intergenic
1136020873 16:27438981-27439003 AGGCAAACACAGGCTGCAAAGGG + Intronic
1136184718 16:28580517-28580539 GTGCAGACAGAAGCAGCGACTGG - Intronic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1137897833 16:52233122-52233144 GGTCAAACACAGGCTGGGAAGGG + Intergenic
1141060194 16:80859835-80859857 GAGCAGACACAGGAGGCTAAGGG + Intergenic
1142291225 16:89194462-89194484 ATGCAGACAGAGCCTCCGAAAGG + Intronic
1143314719 17:6023650-6023672 CTGCAGAGACTGGCTGTGAAGGG + Intronic
1146890209 17:36501889-36501911 CTGAAGACAGAGGCTGCCAAAGG + Intronic
1147451169 17:40505412-40505434 GTGAAGACACAGACTGAGACTGG - Intergenic
1148793429 17:50186150-50186172 GTTCAGACACAGGCTGCCGATGG - Intronic
1150158785 17:62876207-62876229 GGGCAGGCCCAGGCTGTGAAGGG - Intergenic
1152810466 17:82379500-82379522 GAGCAGGCAGAGGCTGGGAAAGG + Intergenic
1155760563 18:29560032-29560054 GTGCAGACAGAGGCAGGGTATGG + Intergenic
1155795573 18:30032461-30032483 ATGCTGACACAGGCTGTGTAGGG + Intergenic
1156019415 18:32582733-32582755 GTGAAGGCAAAGGCTGTGAAAGG + Intergenic
1156482483 18:37444993-37445015 GTGCAGACAGAGGCTGGGTGGGG + Intronic
1158157636 18:54443461-54443483 GTGCACACAAAGGCTGTGAGGGG - Intergenic
1158405476 18:57155860-57155882 GGGCAGCCACAGGCTAGGAATGG + Intergenic
1158849699 18:61482997-61483019 GTGCAGATGCAGGATGCAAAGGG - Intronic
1158933280 18:62341813-62341835 GAGGAGACTCAGGCTGAGAATGG + Intronic
1159015897 18:63101494-63101516 GTGCAGACACAGGCTCTGGGAGG + Intergenic
1163241108 19:16064465-16064487 GGGGAGACACAGGCTAGGAATGG - Intergenic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163501445 19:17678822-17678844 ATGCTGACAGAGGCTGAGAAAGG + Intronic
1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG + Intergenic
1165070655 19:33253279-33253301 GTGCAGACACCTGCTGGGAACGG + Intergenic
1166212898 19:41318678-41318700 GTGCAGAAACAGGCAGCCAGGGG + Intronic
1166423601 19:42656770-42656792 GTGCTGGCACAGGGTGTGAATGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
925793783 2:7521109-7521131 GTGCAGACAGAGGCGGTGTAAGG + Intergenic
928018329 2:27680109-27680131 CTGCAGACATCGGCTGCTAAAGG - Intronic
930576515 2:53157062-53157084 ATTCAGACACATGCTGCAAATGG - Intergenic
942076105 2:172358566-172358588 GTGCAGACAGAGGCAGAGATGGG + Intergenic
944087227 2:195863482-195863504 GAGCAGAAAAAGGCAGCGAATGG - Intronic
944472288 2:200066797-200066819 CTGCAAACCCAGGCTGGGAAGGG - Intergenic
945243598 2:207698494-207698516 GTGAAGACACAGGGAGGGAATGG - Intergenic
1171519354 20:25764318-25764340 GTGAGGAAACAGGCTGCGGATGG - Intronic
1171557569 20:26092173-26092195 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1172599402 20:36173534-36173556 CTGCAGACACAGGGTGGGAGGGG + Intronic
1174566674 20:51469711-51469733 GTGCAGACAGAGGCAGAGACTGG + Intronic
1175199382 20:57267083-57267105 GCGCAGAGACAGGCTGGCAACGG - Intergenic
1175709956 20:61211643-61211665 GAGCAGACTGAGGCTGTGAATGG + Intergenic
1176186645 20:63783879-63783901 CTGCTGAAACAGGCTGTGAAAGG + Intronic
1176653496 21:9570599-9570621 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1176667050 21:9697297-9697319 GTGGCAACACAGGCTGAGAATGG + Intergenic
1179165217 21:38930252-38930274 GTGCCGTCACAGGCTGATAAGGG + Intergenic
1179261273 21:39760114-39760136 GTGCACACACAGGTTGATAATGG - Intronic
1179572321 21:42284995-42285017 GTGGAACCACAGGCAGCGAAGGG + Intronic
1180720172 22:17902106-17902128 GTGGAGACAGAGGCTGTGCACGG + Intronic
1182435913 22:30329735-30329757 CTGCAGCCACAGGCTGTGATGGG - Intergenic
1182604245 22:31490660-31490682 GTGCAGACTCAGGCTGACAGGGG + Intronic
1184779179 22:46637783-46637805 GTGCAGACCCAGGGTGCCACAGG + Intronic
1184997013 22:48214667-48214689 GTGCAGAAACAGGCTGGAAGTGG + Intergenic
949875287 3:8622718-8622740 GTGCAGACAGAGACAGAGAAGGG + Intronic
950154571 3:10711980-10712002 GTGCTGACATAGCCTGGGAAAGG + Intergenic
950873525 3:16249660-16249682 GTGCAGGGACAGGCTGGGGAGGG + Intergenic
952307858 3:32161322-32161344 GTTCACAAACAGGCTGCCAAAGG + Intronic
953114849 3:39982283-39982305 TTGCTGACACAGACTGTGAAAGG - Intronic
956820390 3:72948898-72948920 GTGCAGACACAGGGAGCCCAGGG + Intronic
958806828 3:98821755-98821777 ATGCAGACACTGGCTGGGCACGG + Intronic
960615567 3:119592805-119592827 GTTCAGAAACAGGCAGCGCAAGG - Intergenic
962635674 3:137329104-137329126 GTGTAGACACAGCCTGTGTAGGG + Intergenic
964128020 3:153257015-153257037 GTGCAGAAACAGGCTGGGTGCGG + Intergenic
966934008 3:184693806-184693828 GTGCACACACAGGCGAGGAATGG + Intergenic
967291755 3:187927679-187927701 GTGCAGACTAAGGCTGGAAATGG + Intergenic
967952711 3:194853251-194853273 ATGCAGCCACAGGCTGTGGAAGG + Intergenic
968963680 4:3758578-3758600 GTGCAAGCAGAGGCTGGGAACGG + Intergenic
969107481 4:4818692-4818714 CTGCAGACAGAGGCTCCAAAAGG + Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970566272 4:17335189-17335211 GTGCAGACAGAGGCAGAGACTGG + Intergenic
971161280 4:24136659-24136681 GTGAGGAAACAGGCTGGGAAAGG - Intergenic
977474677 4:97490487-97490509 GTACAGATAGAGGCTGAGAATGG - Intronic
978013854 4:103720069-103720091 GTGCAATCACAGCCAGCGAAGGG - Intergenic
983173318 4:164559592-164559614 GTGGTGACAGAGGCTGGGAAGGG - Intergenic
983380266 4:166982190-166982212 GTGAAGACACTGGCTGCAACAGG - Intronic
985407963 4:189655040-189655062 GTGGCAACACAGGCTGAGAATGG - Intergenic
986735864 5:10666806-10666828 ATGTAGACACAGGCATCGAATGG - Intergenic
990743656 5:58937107-58937129 GTGCAGGCACTGGCTGTGATAGG + Intergenic
996307852 5:122070536-122070558 GTGCAGACATAGACTGCCAGTGG - Exonic
1001547332 5:172578831-172578853 GTGCAGACACAGGCAGGGCCTGG + Intergenic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1006398969 6:33804965-33804987 GGGCACACACAGGCTTAGAATGG + Intergenic
1006912437 6:37572119-37572141 GCCCTGACACAGGCTGAGAAGGG + Intergenic
1010082609 6:71881714-71881736 GTGGAGACACAGGCAGAAAATGG - Intergenic
1010777689 6:79905999-79906021 GTGAAGACACAGGCAGAGACTGG - Intergenic
1012474893 6:99607438-99607460 GGGAAAACACAAGCTGCGAATGG - Intronic
1015347093 6:132173284-132173306 GTGCTGACACAGTTTGCTAAAGG - Intergenic
1015411606 6:132899732-132899754 GTGCATACTCTGGCTGAGAAAGG - Intergenic
1015892457 6:137982403-137982425 GTGAAGACGTAGGCTGTGAAAGG - Intergenic
1019441585 7:1050183-1050205 GTGCACAGGCAGGCTGGGAAAGG - Intronic
1019575665 7:1736525-1736547 GTGATGACACAGGCCGCGGAAGG + Intronic
1019758396 7:2790084-2790106 GAGCAGACACAGGCAGGGACTGG - Intronic
1021677530 7:23096846-23096868 GTGAAGACACAGGCTGCAGTGGG + Intergenic
1022231618 7:28419420-28419442 ATGCAGACAGAGACTGCAAATGG - Intronic
1025206134 7:56994301-56994323 GTGCAGGCACAGGCAGGGATAGG + Intergenic
1025279835 7:57619258-57619280 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1025304897 7:57846243-57846265 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1025665807 7:63582638-63582660 GTGCAGGCACAGGCAGGGATAGG - Intergenic
1026215311 7:68343149-68343171 GTGCAGAAACAGACTTCTAAAGG - Intergenic
1027645519 7:80792863-80792885 GTGCAGACAGAGTCTACAAAGGG - Intronic
1030136558 7:106257324-106257346 ATGCACATACAGGCTGGGAATGG + Intronic
1034487389 7:151374393-151374415 GCCCAGACACAGGCTGCGTGAGG + Intronic
1037318044 8:17617446-17617468 GTACAGACACTGGCTCTGAAGGG + Intronic
1037660057 8:20918741-20918763 GTGAAGACACAGGATGAGATGGG + Intergenic
1037882960 8:22581756-22581778 GTGCAGTCACAGGCTGGGCAGGG + Intronic
1038055262 8:23852096-23852118 GTGCATACACATGCTGAGATGGG + Intronic
1039478049 8:37851572-37851594 GGGCACACACAGGCTGGGAGGGG + Intergenic
1043969004 8:86509462-86509484 GTGGAAACACAGACTGCAAAGGG + Intronic
1047700154 8:127441630-127441652 GTGCACACACAGCCTGTGACTGG - Intergenic
1048930280 8:139309545-139309567 GTGCAGAAACAGGCTGGGTGTGG - Intergenic
1049511014 8:143026686-143026708 GTGCAGACAGAGCCTGGGAGGGG + Intergenic
1055877103 9:80956265-80956287 GTGAAGACAGAGGCTGAGACTGG + Intergenic
1057181218 9:93031690-93031712 CTGCAGGCACTGGCTGCTAAGGG - Intronic
1057740992 9:97711083-97711105 GTCCAGACACAGGCTGTGTCTGG - Intergenic
1057796539 9:98161864-98161886 GTGCACAGACAGGCTGTGGAGGG - Intronic
1058794901 9:108488568-108488590 GTGAAGACAGAGGCAGAGAATGG - Intergenic
1059253785 9:112910386-112910408 GAGCAGCCACAGTCTGAGAAAGG + Intergenic
1059403452 9:114085313-114085335 GGGCAGACAGAGGGTGAGAAAGG + Intergenic
1062546376 9:137065366-137065388 GGGCAGCCACAGGCGGAGAAAGG + Intronic
1203631216 Un_KI270750v1:74046-74068 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1203659046 Un_KI270753v1:24465-24487 GTGGCAACACAGGCTGAGAATGG - Intergenic
1185598198 X:1321177-1321199 GTGCAGACAGAGGCCGGGCACGG + Intergenic
1185867401 X:3636255-3636277 GTGCAGACACAGGCTGCGAAGGG + Intronic
1186726213 X:12361885-12361907 GTGAAGACACAGGCAGAGATTGG - Intronic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190545356 X:51520125-51520147 GTGAATACACAGGCTCAGAAAGG - Intergenic
1191675861 X:63791799-63791821 GTGCAGAAAAAAGCTGTGAAAGG + Intergenic
1199948761 X:152688691-152688713 GTGAAGACACAGGAAGAGAATGG + Intergenic
1199960915 X:152779758-152779780 GTGAAGACACAGGAAGAGAATGG - Intergenic
1200169728 X:154063858-154063880 GTGAAGACACAAGCAGAGAATGG + Intronic
1200796588 Y:7346437-7346459 GTGCAGACACGGGCTGCGAAGGG - Intergenic