ID: 1185874059

View in Genome Browser
Species Human (GRCh38)
Location X:3687854-3687876
Sequence GAGGAACACGATGCTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185874059_1185874066 27 Left 1185874059 X:3687854-3687876 CCAAGGACAGCATCGTGTTCCTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1185874066 X:3687904-3687926 TGGAAAATACACTTCAAAAAAGG 0: 1
1: 0
2: 1
3: 51
4: 618
1185874059_1185874062 -4 Left 1185874059 X:3687854-3687876 CCAAGGACAGCATCGTGTTCCTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1185874062 X:3687873-3687895 CCTCATGGACACTCCAAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 151
1185874059_1185874064 7 Left 1185874059 X:3687854-3687876 CCAAGGACAGCATCGTGTTCCTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1185874064 X:3687884-3687906 CTCCAAGAGAGGTGGCTACATGG 0: 1
1: 0
2: 1
3: 22
4: 141
1185874059_1185874063 -1 Left 1185874059 X:3687854-3687876 CCAAGGACAGCATCGTGTTCCTC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1185874063 X:3687876-3687898 CATGGACACTCCAAGAGAGGTGG 0: 1
1: 0
2: 2
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185874059 Original CRISPR GAGGAACACGATGCTGTCCT TGG (reversed) Intronic
901425522 1:9180501-9180523 GATGAACAAGATGCTGCCCTTGG - Intergenic
902597612 1:17520131-17520153 GAGGACCAGGAAGCTGGCCTGGG - Intergenic
905396954 1:37672837-37672859 GAGGCTCACGTTGCTGGCCTGGG + Intergenic
906126434 1:43429895-43429917 GAGGGACAGGATTCTCTCCTGGG + Intronic
907451714 1:54549668-54549690 GAGCAACACGAGGCTGCTCTTGG + Intronic
907684676 1:56599015-56599037 GAGGAACACTGTGCTGTTATTGG - Intronic
910831270 1:91464675-91464697 GAGGACCACGATGATGTTTTTGG + Intergenic
917263757 1:173197515-173197537 AAGGAACAAGATCATGTCCTTGG + Intronic
919974201 1:202600250-202600272 GAGGAACACTTTGCTGCCCTGGG - Intronic
920335429 1:205241989-205242011 GAGGTACACGTTGCTGCCGTCGG - Exonic
921106173 1:211981157-211981179 CTGGAACAAGATGCTGTCTTTGG - Exonic
921458920 1:215405826-215405848 GAAGAACAAGATCATGTCCTTGG + Intergenic
1063302228 10:4860465-4860487 CAGGACAACAATGCTGTCCTTGG - Intergenic
1063342063 10:5275271-5275293 CAGGAAGAAGCTGCTGTCCTGGG - Intergenic
1064098066 10:12438894-12438916 AAGTAACACGGTGCTGTCCAAGG - Intronic
1068741148 10:60472884-60472906 GAAGAAGAGGATGCTGTCATAGG - Intronic
1068996706 10:63213949-63213971 GAGGAAAAGGATGCTGGCTTAGG + Exonic
1073327288 10:102650270-102650292 GAGGGACATGAGGCTTTCCTGGG + Intronic
1075033094 10:119040238-119040260 GAGGAAAATGATGCTGACCCAGG + Intronic
1075777512 10:124998066-124998088 GAGGAACACGTGGCTGTACCAGG - Exonic
1076033162 10:127176197-127176219 GAGGGACACACAGCTGTCCTCGG - Exonic
1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG + Intergenic
1077232164 11:1462741-1462763 GGGGAACAAGAAGCTGTCCCGGG - Intergenic
1089374709 11:117986249-117986271 GGGCAACCCGAGGCTGTCCTGGG - Intergenic
1094032578 12:26029664-26029686 GAGGAACAAGATCATTTCCTTGG + Intronic
1099826216 12:87780494-87780516 GAGGAGAATAATGCTGTCCTGGG - Intergenic
1101322874 12:103688696-103688718 AAGCAACAGGAAGCTGTCCTGGG - Intronic
1104561024 12:129844625-129844647 GAGAAGAACGATGCTGTGCTTGG + Intronic
1105472622 13:20706022-20706044 CAGGACCCCTATGCTGTCCTGGG + Intronic
1108142028 13:47433648-47433670 GAGTCACACAATGCTGTCCAGGG - Intergenic
1112705806 13:102068430-102068452 GAGGAAGACGACTCTGGCCTTGG - Intronic
1122098820 14:99391227-99391249 GAGGAACAGGATGGCCTCCTGGG - Intergenic
1126471344 15:49014194-49014216 GAGGAAAAGGATGTAGTCCTTGG - Intronic
1127161576 15:56192661-56192683 AAGGAACAGGATGCTTTCCCAGG + Intronic
1127647080 15:60969652-60969674 GAGGGATAGGATGCTGTCATCGG - Intronic
1128581992 15:68817446-68817468 GGGGAACAGGCTGCTGTCCTTGG + Intronic
1129737912 15:77976078-77976100 GGGGAAGTCGATGATGTCCTTGG - Intergenic
1130130979 15:81142516-81142538 TAGGAGCACGGTGCTTTCCTGGG - Intronic
1131343842 15:91627900-91627922 GAGGAAGACGGGGCTGTCATTGG - Intergenic
1131678830 15:94700545-94700567 GAGGCACACAATTGTGTCCTGGG - Intergenic
1132728608 16:1349691-1349713 GAGGAAGAGGAATCTGTCCTCGG - Intronic
1134617206 16:15660819-15660841 CAGGAAGACTGTGCTGTCCTGGG - Intronic
1136397515 16:30001245-30001267 CAGCAGCAGGATGCTGTCCTGGG - Intronic
1203116541 16_KI270728v1_random:1496350-1496372 GAGGAACACGTTAATGCCCTAGG + Intergenic
1147644116 17:42023649-42023671 AAGGACCACGATGGTGACCTGGG - Exonic
1147676777 17:42212065-42212087 CAGGAACACGAGGTTCTCCTTGG + Exonic
1147689422 17:42306344-42306366 CAGGAACACGAGGTTCTCCTTGG - Exonic
1149045972 17:52246052-52246074 CAGAAACATGATGCTGTCATCGG - Intergenic
1149460210 17:56822989-56823011 CAGGAACATGATGCTGACCTTGG - Intronic
1149561458 17:57610738-57610760 AAGGAACATGCTGCTGCCCTAGG + Intronic
1150137083 17:62701980-62702002 GATGACCAAGATGCTGTCTTTGG - Intronic
1150628558 17:66859544-66859566 GAGAAACACGGTGCTGCCCAAGG - Intronic
1151471614 17:74321857-74321879 GTGGAACAGGATGCTGTGATGGG + Intergenic
1152278318 17:79371071-79371093 GAGGGACACCGTGCTGGCCTGGG - Intronic
1152565722 17:81099510-81099532 AAGGACCAAGAAGCTGTCCTGGG + Intronic
1153216621 18:2826786-2826808 GAGGATGACTATTCTGTCCTCGG + Intergenic
1158782055 18:60663481-60663503 GAGGAACACGTGGCTGTGCCAGG + Intergenic
1162965950 19:14156184-14156206 GAGGAACACCAGGTTGACCTGGG + Exonic
926060665 2:9802809-9802831 GGGGAACACGGAGCTTTCCTGGG - Intergenic
927100825 2:19786626-19786648 GAGGAACATGACTCAGTCCTTGG - Intergenic
934236188 2:90234853-90234875 GAGGAAGAAGAAGCTGTGCTGGG - Intergenic
939173435 2:138722499-138722521 GAGCAACAGGAAGCTGTCCTGGG + Intronic
939231756 2:139435630-139435652 GAGGAAAACTTTGCTTTCCTAGG + Intergenic
940190891 2:151038934-151038956 GAGGAGGAGGAGGCTGTCCTAGG + Intronic
940195945 2:151094365-151094387 AAGGAACAAGATCATGTCCTCGG + Intergenic
940517537 2:154699242-154699264 GAGGAAGAGGATGATGCCCTCGG - Exonic
946280557 2:218662958-218662980 CATGAACACGATGCGGGCCTCGG - Exonic
948053592 2:234995662-234995684 GAGAAACACGGGGCTGTTCTGGG - Intronic
948086420 2:235253598-235253620 AAGGAACAAGATCATGTCCTTGG - Intergenic
1170571825 20:17637001-17637023 GAGACACACGGTGCTGTCCCTGG + Intronic
1174109694 20:48190046-48190068 GAAGAACAAGAGGCTTTCCTTGG + Intergenic
1174527555 20:51185763-51185785 GAGAAACAAGACGCAGTCCTTGG + Intergenic
1179116022 21:38493625-38493647 CAGGAGCACGATGCAGTCATAGG + Intronic
1183513779 22:38251343-38251365 GAGGAAAACGATGCAGAACTTGG + Intronic
1185212988 22:49582281-49582303 GAGGAAGATGCTGCTGCCCTAGG + Intronic
951465954 3:23000717-23000739 AAGGGACAGGATGCTGTCCGCGG + Intergenic
951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG + Intronic
965119505 3:164534318-164534340 TAGAAACTGGATGCTGTCCTTGG + Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966445511 3:179997268-179997290 GAGGACCACAATGCTGTTTTGGG - Intronic
968086255 3:195875275-195875297 GAGGCACACGAAGCTCCCCTCGG + Intronic
969455319 4:7296939-7296961 AAGGAGCACGAAGCTGGCCTGGG - Intronic
976260065 4:83136887-83136909 GAGGAAAAGTATCCTGTCCTTGG - Intronic
976688212 4:87839495-87839517 AAGGAACAAGTTGCTGTCTTCGG + Intronic
978370331 4:108023536-108023558 AAGAAACAGGATGCTTTCCTAGG - Exonic
982486757 4:155975641-155975663 GAAGAACACTGTGTTGTCCTGGG + Intergenic
982491892 4:156039797-156039819 GAGGAAAACTATCCTGGCCTTGG + Intergenic
984167484 4:176320076-176320098 GATGAACACGGTGCTGTCGCGGG + Exonic
984205317 4:176780465-176780487 GATGAACTCCATGCTGTCCTTGG - Intronic
986012542 5:3729100-3729122 GAGTAACATGAAGCTGTCATAGG + Intergenic
987153005 5:15060368-15060390 GAGGAACACAATGATGTTTTGGG - Intergenic
987504228 5:18748565-18748587 GAGGACCACGATGATGTTTTGGG - Intergenic
991630152 5:68648601-68648623 GAGGCAAACAAAGCTGTCCTCGG + Intergenic
994336760 5:98576364-98576386 GAGGAACACGTGGCTGTACCAGG + Intergenic
996022434 5:118605976-118605998 GAGGAACAAGAGGCTGCACTTGG - Intergenic
997249830 5:132380020-132380042 GAGGAAGTCGTTGTTGTCCTTGG + Intronic
998011343 5:138697813-138697835 GAGGAACACCCTTCTGTGCTTGG - Intronic
999283996 5:150383118-150383140 GAGGAACACGGAGGGGTCCTCGG + Intronic
1000908508 5:166993086-166993108 GAGGAACCAGGTGCTTTCCTTGG + Intergenic
1001084292 5:168689381-168689403 GAGTAACCGCATGCTGTCCTTGG + Intronic
1001483692 5:172105201-172105223 GTGGAACATGCTGCTGTCCCAGG + Intronic
1007320613 6:41026482-41026504 AAGGAACACAATGATGTCTTTGG + Intergenic
1008786475 6:55174763-55174785 GACGAACACGATGATGTACCCGG - Exonic
1012411809 6:98967038-98967060 GAGGGACACGGTGCTCTGCTGGG - Intergenic
1016569721 6:145498202-145498224 CAGGAACACCAACCTGTCCTGGG + Intergenic
1016989362 6:149918660-149918682 GAGGGTCACGAGGCTGGCCTTGG + Intronic
1018189869 6:161301235-161301257 GGGGAACACAAAGCTGTCTTTGG + Intergenic
1019153064 6:170021901-170021923 CAGGAACAGGAAGCTGTCCCAGG + Intergenic
1020094252 7:5359468-5359490 GAGGAACATGATGCCCTCATCGG - Exonic
1024292540 7:47815166-47815188 AAGGAACAGGATGCTCTGCTGGG + Intronic
1026355042 7:69550246-69550268 GAGGCTCAGGTTGCTGTCCTGGG + Intergenic
1030463368 7:109868736-109868758 GAGCAATACTAAGCTGTCCTTGG - Intergenic
1030680712 7:112430884-112430906 GGGGAACACGGTGCTGACCTAGG - Intronic
1036706390 8:11050046-11050068 GAGCAACACGCTCCAGTCCTCGG + Intronic
1037267060 8:17075204-17075226 GTTGAACACGCTGCTGTGCTAGG - Intronic
1037815152 8:22108146-22108168 GAGGAACACGAAGCGGACCCAGG + Exonic
1038953714 8:32444693-32444715 GAGGAACAGCATTCTTTCCTGGG + Intronic
1039951995 8:42180008-42180030 GCGGACCACGCTGCTCTCCTGGG + Exonic
1039981128 8:42410797-42410819 GAGGAGGACGGTGCTGTCCTGGG + Intergenic
1046150643 8:110220045-110220067 GAGGGAAACGTTGCTCTCCTAGG - Intergenic
1050401373 9:5259400-5259422 GAGAAAGAGAATGCTGTCCTAGG + Intergenic
1053303624 9:36969047-36969069 GAGGAACTTGGTGGTGTCCTGGG - Intronic
1059846624 9:118285697-118285719 GAGGAAAAGGATGATTTCCTAGG + Intergenic
1060938276 9:127528349-127528371 GAGGAACACTGTACTCTCCTGGG - Intronic
1062242009 9:135545935-135545957 AAGACACACGATGCTGTCCAGGG - Intergenic
1062645077 9:137543731-137543753 GAGGACCAAGGTGCTGTCTTTGG - Exonic
1185874059 X:3687854-3687876 GAGGAACACGATGCTGTCCTTGG - Intronic
1188456365 X:30371085-30371107 AAGGAACAGGATTCTCTCCTGGG + Intergenic
1197722522 X:129754983-129755005 GAGGTACAGGATGCTCTCCCAGG + Intronic
1200607351 Y:5281909-5281931 GTGGAACAGAATGCTGTCATAGG + Intronic