ID: 1185874355

View in Genome Browser
Species Human (GRCh38)
Location X:3690157-3690179
Sequence TTGCTGCTATAACCAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185874355 Original CRISPR TTGCTGCTATAACCAGTGGG TGG Intronic
902890600 1:19440590-19440612 GTGCTCCTATGACCAGTGTGGGG + Intronic
903898717 1:26626529-26626551 TGGATGCTAAAACTAGTGGGTGG + Intergenic
907409333 1:54273684-54273706 TTGCTCCTCTGTCCAGTGGGGGG - Intronic
908341257 1:63181880-63181902 TTGCTGCTGTAACAGGTGTGTGG - Intergenic
909169919 1:72282443-72282465 TTGTTGCTCGAACCAGTGGCTGG - Exonic
910447903 1:87317535-87317557 TTGCTACTAGCATCAGTGGGTGG - Intergenic
918599222 1:186334394-186334416 TTGCAGGTGTAACCATTGGGCGG + Exonic
1062941012 10:1421426-1421448 TTACTCCTAAAAGCAGTGGGAGG + Intronic
1070371981 10:75791283-75791305 TTGATGGTATAACAAGGGGGTGG - Intronic
1073281687 10:102359250-102359272 TTCCTGCTATGACCAGTAGCAGG - Exonic
1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG + Intergenic
1074981959 10:118627034-118627056 TTCTTGCTATAGCCAGGGGGAGG - Intergenic
1075277205 10:121104880-121104902 TTGCTAGTAGAAGCAGTGGGAGG - Intergenic
1078414435 11:11153828-11153850 TTTCTGCAATAACCAGAGTGTGG + Intergenic
1079969780 11:27021975-27021997 TTGCTCTTATATCCAGTAGGTGG - Intergenic
1080961854 11:37169785-37169807 TTGCTGCTAGAATCAGTGTCTGG + Intergenic
1086109599 11:83185310-83185332 TTGCTTCTTTAATCAGTGGGAGG - Exonic
1087130146 11:94662276-94662298 CTGCTGCTTTAAATAGTGGGAGG + Intergenic
1092090505 12:5799922-5799944 TTACTGCTGTATCCAGTGTGGGG - Intronic
1098377157 12:69829134-69829156 TAGCTGCTAGAACCTGTGGAAGG + Intronic
1099327128 12:81231529-81231551 TTGCTCATATAACCAGTAAGAGG - Intronic
1101298348 12:103450713-103450735 TTCATGGTAGAACCAGTGGGTGG - Intronic
1103479975 12:121244613-121244635 TTGCTGGAATCACCAGAGGGAGG + Exonic
1105314039 13:19241076-19241098 TTGCTGAAATGACCACTGGGTGG + Intergenic
1111176487 13:84602955-84602977 CTGCTGCAATAAACATTGGGGGG + Intergenic
1112942060 13:104875283-104875305 TTTCTGCTGTAATCAGAGGGTGG + Intergenic
1115119724 14:29926435-29926457 TTGCTACTGTAAACAGTGGTGGG + Intronic
1118916300 14:70109814-70109836 TTTCTGCTTTAACAAGTAGGTGG - Intronic
1125399899 15:39291004-39291026 TTGCTGGTATGAGCAGAGGGAGG + Intergenic
1128648535 15:69394344-69394366 GTGCTGCTATAGCCAGTTAGGGG + Intronic
1131672868 15:94639017-94639039 ATGCTGCTATAAGCATTTGGTGG - Intergenic
1132461999 16:60130-60152 TCTCTGGTATCACCAGTGGGTGG + Intronic
1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG + Intronic
1138532065 16:57639853-57639875 TTGATGGTGTAGCCAGTGGGTGG + Intronic
1145242240 17:21246836-21246858 GTGCTGTTCTCACCAGTGGGCGG - Intronic
1150907490 17:69353579-69353601 TTGGTGCTATAATCATTGGGGGG + Intergenic
1151025921 17:70676792-70676814 TTGCTGGTATAAAGAGTGGAAGG - Intergenic
1151418707 17:73983643-73983665 CTGCTGCAATCACCTGTGGGCGG - Intergenic
1153170761 18:2313215-2313237 TTGCTTCCATCACTAGTGGGAGG + Intergenic
1159822323 18:73161454-73161476 CTGCTGCTGGACCCAGTGGGAGG - Exonic
1163227156 19:15971578-15971600 ATGCTGCTATAAACAGTGTGTGG - Intergenic
1164189011 19:22898446-22898468 TTGATGCCATAACAGGTGGGTGG - Intergenic
927664624 2:25022030-25022052 TTGCTTCCCTAACCAGAGGGAGG + Intergenic
930241449 2:48939622-48939644 TTGATGCTTTAGCCAGTGAGTGG - Intergenic
934115452 2:88787020-88787042 GTACTGCTAAAACCAGAGGGAGG + Intergenic
934631195 2:95924974-95924996 GTACTGCTAAAACCAGAGGGAGG - Intronic
934802849 2:97184010-97184032 GTACTGCTAAAACCAGAGGGAGG + Intronic
934833354 2:97556559-97556581 GTACTGCTAAAACCAGAGGGAGG - Intronic
935856728 2:107282518-107282540 TTCCTGCTTTCAGCAGTGGGAGG - Intergenic
944360098 2:198844119-198844141 TTGTTGCTAGATCCAATGGGTGG + Intergenic
945312703 2:208333461-208333483 TTTCTCCTATAACCAGATGGTGG + Exonic
946402303 2:219474767-219474789 TTGCTGCTGCAAACATTGGGAGG - Intronic
947406313 2:229781143-229781165 TTGCTGATACAACCTGGGGGTGG + Intronic
947507041 2:230715667-230715689 TTGCTACTATAACAAATGGGTGG + Intronic
1176725629 21:10430194-10430216 GTGCTACTATATCTAGTGGGTGG - Intergenic
1177273564 21:18877858-18877880 ATGCTGCTACCACCAGTGGCTGG + Intergenic
1179403953 21:41110236-41110258 TTGATGCTATGGCCTGTGGGAGG - Intergenic
1179412725 21:41174673-41174695 TTCCTGCTGTACCCAGTGTGGGG - Intronic
1185259073 22:49851712-49851734 CTCCTGCTAGAATCAGTGGGAGG - Intergenic
953940653 3:47092872-47092894 TTGCTGTTATAACCAGGAAGGGG - Intronic
954068539 3:48126124-48126146 CTGCTGCTATGGTCAGTGGGGGG - Intergenic
955655465 3:61240495-61240517 TTGTTTCTATAGCCAGTTGGAGG - Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
961793971 3:129396324-129396346 TTGCTCCTATAACCAATGCTGGG + Intergenic
963165906 3:142203214-142203236 TTGCTGCAATAACTTGTGAGAGG - Intronic
973316652 4:48767644-48767666 TGGTTGCCAGAACCAGTGGGTGG + Intronic
976505514 4:85841899-85841921 TGGCTGGTACAACCAGTGGCTGG - Intronic
978424504 4:108567949-108567971 ATGCTGCAATATCCAGTGGGAGG - Intergenic
984198081 4:176684249-176684271 TTGCTGATATAACAAATGGAAGG + Intronic
988101149 5:26680509-26680531 TGGCTGCTACAACTCGTGGGTGG + Intergenic
996107742 5:119525011-119525033 TTGCCACTAAAATCAGTGGGAGG - Intronic
999667501 5:153928427-153928449 TTCCTTCTATAACCAGTTGAGGG - Intergenic
1004776364 6:18850372-18850394 TGGATGCTAAAACCAGTGGGTGG - Intergenic
1012378506 6:98591067-98591089 TTGCTGCCATAAGCAGGGGTAGG + Intergenic
1017129964 6:151099691-151099713 TTGCTCCCATAACCAGTGTTGGG - Intronic
1020638003 7:10719738-10719760 TTGCAGTTAAAAACAGTGGGAGG - Intergenic
1020760476 7:12262331-12262353 TTTCTGCCATAAACAGTGTGGGG - Intergenic
1022968966 7:35499423-35499445 TTGCTGCTATTACTAGGGAGAGG + Intergenic
1026567585 7:71502218-71502240 TTGCTGCAAAAATCAATGGGTGG - Intronic
1029162375 7:98561789-98561811 TTGGTGGTAGAGCCAGTGGGAGG - Intergenic
1032343792 7:131100801-131100823 TTGTTGCTATTAGCAGTGGTGGG + Intergenic
1032718017 7:134527543-134527565 CTGCTGCTATCTACAGTGGGAGG - Intergenic
1034477132 7:151291825-151291847 ATGCTGCTTCCACCAGTGGGTGG - Intergenic
1038038755 8:23706786-23706808 TTTCTGCGAGAACCAATGGGGGG - Intergenic
1038274945 8:26113596-26113618 TTGTTGCTAGAAGCTGTGGGTGG + Intergenic
1040906710 8:52476625-52476647 CTGCTGCTCTACCCAGTAGGAGG - Intergenic
1041322154 8:56624372-56624394 TGGCTCCTATCACTAGTGGGTGG - Intergenic
1043788416 8:84431892-84431914 TTGGTTATATACCCAGTGGGGGG + Intronic
1048269852 8:133019880-133019902 TTGTGGCTAGAACCAGTGAGTGG + Intronic
1051278132 9:15416657-15416679 TTGCTGCTATTACTAGTGCCAGG + Intergenic
1061237048 9:129349347-129349369 TTGCTGTTATTCCCAGTGAGGGG + Intergenic
1185874355 X:3690157-3690179 TTGCTGCTATAACCAGTGGGTGG + Intronic
1187539826 X:20181713-20181735 TGGTTGCTAAAACCAGTGGCAGG - Intronic
1188610647 X:32092314-32092336 TTGCTGCTTTAAGCACAGGGTGG - Intronic
1194198648 X:90928469-90928491 TTGCTGGTATTACCAGAGTGTGG + Intergenic
1196164581 X:112524515-112524537 CTGCTGCTCTAACAAGTGTGAGG + Intergenic
1198919853 X:141713282-141713304 TGGTTGCTATAACTGGTGGGAGG + Intergenic
1200544643 Y:4504913-4504935 TTGCTGGTATTACCAGAGTGTGG + Intergenic
1200935007 Y:8730622-8730644 TTCCTGCTATTACAAGAGGGTGG - Intergenic