ID: 1185877599

View in Genome Browser
Species Human (GRCh38)
Location X:3713239-3713261
Sequence GCGTCCCCATGGAGGCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 4, 2: 0, 3: 5, 4: 110}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185877599_1185877614 17 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877614 X:3713279-3713301 CGGGCCAGGCCGGAGCGCTCGGG 0: 3
1: 3
2: 3
3: 16
4: 219
1185877599_1185877605 -10 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877605 X:3713252-3713274 ATGGGGACGCACTCAGGTCCGGG 0: 4
1: 1
2: 2
3: 5
4: 101
1185877599_1185877618 25 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877618 X:3713287-3713309 GCCGGAGCGCTCGGGGAGCCGGG 0: 4
1: 1
2: 1
3: 22
4: 176
1185877599_1185877607 -3 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877607 X:3713259-3713281 CGCACTCAGGTCCGGGGCACCGG 0: 1
1: 4
2: 4
3: 7
4: 111
1185877599_1185877617 24 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877617 X:3713286-3713308 GGCCGGAGCGCTCGGGGAGCCGG 0: 4
1: 2
2: 3
3: 27
4: 241
1185877599_1185877610 7 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877610 X:3713269-3713291 TCCGGGGCACCGGGCCAGGCCGG 0: 2
1: 1
2: 3
3: 31
4: 277
1185877599_1185877606 -9 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877606 X:3713253-3713275 TGGGGACGCACTCAGGTCCGGGG 0: 4
1: 1
2: 1
3: 7
4: 75
1185877599_1185877615 18 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877615 X:3713280-3713302 GGGCCAGGCCGGAGCGCTCGGGG 0: 1
1: 4
2: 2
3: 10
4: 212
1185877599_1185877608 -2 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877608 X:3713260-3713282 GCACTCAGGTCCGGGGCACCGGG 0: 1
1: 5
2: 0
3: 6
4: 137
1185877599_1185877609 3 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877609 X:3713265-3713287 CAGGTCCGGGGCACCGGGCCAGG 0: 2
1: 4
2: 2
3: 41
4: 1142
1185877599_1185877613 16 Left 1185877599 X:3713239-3713261 CCCGGGCGCCTCCATGGGGACGC 0: 1
1: 4
2: 0
3: 5
4: 110
Right 1185877613 X:3713278-3713300 CCGGGCCAGGCCGGAGCGCTCGG 0: 3
1: 3
2: 0
3: 16
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185877599 Original CRISPR GCGTCCCCATGGAGGCGCCC GGG (reversed) Exonic
900166664 1:1246731-1246753 CCGTCCCCATGACTGCGCCCTGG - Intergenic
900342948 1:2197302-2197324 GCTCCCCCATGCAGGTGCCCTGG + Intronic
902583926 1:17426451-17426473 GCTTCCCCAAGGAGGCGAACTGG - Intronic
903275945 1:22221960-22221982 GCGTGCCCATGGGTGTGCCCTGG - Intergenic
903322248 1:22550216-22550238 GCGGCCCCACGGAGCAGCCCCGG + Intergenic
906299944 1:44674457-44674479 GCGGCGCCCAGGAGGCGCCCGGG - Exonic
1062877431 10:954338-954360 GCGTCCACATGTAGGAGGCCTGG - Intergenic
1069718037 10:70533113-70533135 TCGTCCCCATGGAGGTGCTCAGG + Intronic
1069834757 10:71301460-71301482 GCATCCACATGGAGGCACCAGGG - Exonic
1070615683 10:77967739-77967761 ACGTCCCCATGGAGACCCCTGGG - Intergenic
1075113595 10:119607789-119607811 GCATCCCTATAGAGGCTCCCCGG + Intergenic
1075495584 10:122916052-122916074 GCCTCCCCAGGGAGGCATCCTGG + Intergenic
1076523521 10:131095480-131095502 GCGTCCCCATGCAGGCGACGTGG - Intronic
1076841345 10:133047361-133047383 GCCTCCCCATGCAGGAGCACAGG + Intergenic
1077149084 11:1060639-1060661 GCGTCCCCATGTCAGCGGCCTGG - Intergenic
1078474981 11:11622194-11622216 CCGCCCCCAGGGACGCGCCCGGG + Intergenic
1081547099 11:44079276-44079298 GCCCCTCCATGGAGGTGCCCGGG + Intronic
1084888978 11:72227487-72227509 GCTTCCCCAAGGAGTCACCCAGG - Intronic
1090917648 11:131180050-131180072 GCTTCCCCCTGGAGGCCTCCAGG + Intergenic
1091222122 11:133935878-133935900 GGGTCTGCATGGAGGGGCCCTGG - Intronic
1092755381 12:11758379-11758401 GCTTCCCCATGCAGGAGCCAAGG + Intronic
1101210795 12:102533645-102533667 GCGTCCAGATTGAGGCGCCTAGG + Intergenic
1101679959 12:106955618-106955640 GGGTTCCCACGGAGGCGTCCAGG + Intergenic
1104969702 12:132525666-132525688 GCGTCCGCATCGGGGCCCCCTGG - Intronic
1107448557 13:40488915-40488937 GCCTTCCCCTTGAGGCGCCCCGG - Intergenic
1113775658 13:112943586-112943608 GAGGCCCCGTGCAGGCGCCCAGG + Intronic
1115670816 14:35609805-35609827 GCCTCCCCAAGTAGGGGCCCTGG - Intronic
1117023851 14:51599886-51599908 GTGTACCCATGGAGGCTCCTGGG + Intronic
1119662485 14:76462050-76462072 GCATCCCACTGGAGGGGCCCAGG - Intronic
1121210921 14:92207468-92207490 GCATCCTCATGGAGCCCCCCTGG - Intergenic
1124184382 15:27510536-27510558 GCCTCCCCATGGGGCCGCCTGGG - Intronic
1124500331 15:30222986-30223008 GCCTCGCCATGGACGCGCGCGGG + Intergenic
1124705872 15:31963669-31963691 GAGGCCCCATGGAGGCCCCATGG - Intergenic
1124743242 15:32315680-32315702 GCCTCGCCATGGACGCGCGCGGG - Intergenic
1127763618 15:62164558-62164580 GGGTCCCCAGGGGGGCGTCCGGG + Exonic
1132493479 16:247919-247941 GAGTCCCCATGGAGGCACTGCGG + Intronic
1135592318 16:23713220-23713242 GCGCTCCCTTGGAGGCACCCAGG - Exonic
1137495830 16:48968544-48968566 CAGTCCCCCTGGAGGGGCCCAGG - Intergenic
1137540163 16:49356420-49356442 GCGTCTCCATGGAGGACCCTGGG - Intergenic
1142072469 16:88098797-88098819 TCGACCCCATGGAGGGACCCTGG - Intronic
1144854129 17:18258676-18258698 GCGGCGCCATGGAGGCCACCGGG - Exonic
1146750424 17:35373615-35373637 GCGTTTCCCTGGAGGCGCCCAGG + Exonic
1146757818 17:35448759-35448781 GCGTTTCCCTGGAGGCGCCAAGG + Exonic
1147193322 17:38749274-38749296 GCGCGCCCAGGGAGGCGCACAGG - Intronic
1148755728 17:49972094-49972116 GCGTCCCCGTAGAGCCGCGCAGG + Intronic
1149685382 17:58531876-58531898 GGGTCCCCTTGCAGCCGCCCGGG + Intronic
1151673920 17:75588484-75588506 GTGTCCCCATTGAGGCTCCTGGG - Intergenic
1152422648 17:80202445-80202467 GCGTCCCCAGAGAGGCCCACAGG + Intronic
1152487484 17:80603701-80603723 CCGCCCCCATGGAGGCTCACAGG + Intronic
1154502648 18:15004368-15004390 GTGTCCCCATGGGTGCGGCCTGG - Intergenic
1156462020 18:37326517-37326539 GTGTCCCCATGGAGGCCCTGTGG + Intronic
1160719140 19:589938-589960 GCCTCGCCATGGACGCGCGCGGG + Exonic
1161273621 19:3403934-3403956 GCGTCCCCATGGAGAGGCTCCGG - Intronic
1161273661 19:3404050-3404072 GCGTCCCCATGGAGAGGTTCGGG - Intronic
1163585505 19:18161415-18161437 GCGGCCCAAAGGTGGCGCCCAGG - Exonic
1163655548 19:18543239-18543261 GGGTCCCGATGGAGGCGTGCAGG - Intronic
1163720082 19:18894667-18894689 GCGGACCCAGGGAGGGGCCCTGG + Intronic
1166020668 19:40025565-40025587 ACCTGCCCATGGAGGAGCCCAGG - Intergenic
1166785164 19:45363209-45363231 GCGTCCCCATGGAGTAGTCTGGG - Intronic
1167293266 19:48635855-48635877 GGGTCCCCGCGGGGGCGCCCGGG - Exonic
925023972 2:593718-593740 GCGTCTCCCTGGGGGTGCCCGGG - Intergenic
925907986 2:8550894-8550916 ACGGGCCCATGGAGGAGCCCAGG + Intergenic
926012843 2:9422652-9422674 GCGTCCCCTGCCAGGCGCCCTGG - Exonic
927958878 2:27226976-27226998 GGGGCCCCATGGGGGTGCCCAGG - Intronic
928434019 2:31242079-31242101 CCGTCCCCAAGGAGGAGCCTCGG - Intronic
928888234 2:36174623-36174645 GCGTCCCCAAGGAGGCACGCAGG + Intergenic
931218254 2:60265753-60265775 GGGACCCCATGGATGCCCCCAGG + Intergenic
938190678 2:129277425-129277447 GCCTCCCCATGAAGTCTCCCTGG - Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948134771 2:235628355-235628377 CTGTCCCCATGGAGGAGCACTGG + Intronic
948183495 2:236001237-236001259 GGCTCCCCATGAAGGCTCCCCGG - Intronic
1172517017 20:35542090-35542112 CGGTCCCCATGGAGGCGCTGGGG + Exonic
1172796676 20:37544521-37544543 TAGTCCCCATGGAGGGGCCGTGG - Intergenic
1175121338 20:56718347-56718369 GCGGCCCGAGGGAGGCGCGCGGG - Intergenic
1175263703 20:57690148-57690170 GGTTCCACATGGAGGCCCCCAGG - Intronic
1175754261 20:61519561-61519583 GGCTCCCCAAGGAGGCTCCCTGG + Intronic
1175955495 20:62606955-62606977 GAGTCCCCAGGGAGGCCCCGTGG - Intergenic
1183593965 22:38798534-38798556 GCCTCCCCATGGCGTGGCCCCGG + Intergenic
1183953694 22:41367102-41367124 GCATCAGCATGGAGGTGCCCTGG - Intergenic
1184358284 22:43997033-43997055 GCGTCCTCCTGGAGGCGCTAAGG + Intronic
1184663627 22:45976601-45976623 ACGTCCCCACGGGGACGCCCCGG + Intronic
1184865525 22:47199845-47199867 GCGTTCTCACGGAGGCCCCCAGG - Intergenic
1185069801 22:48649729-48649751 GTGTCCCCGAGAAGGCGCCCCGG - Intronic
1185275838 22:49949939-49949961 GCTTCCCACTGGAGGGGCCCTGG + Intergenic
949339173 3:3010021-3010043 CCTTCCCCAAGGAGGCTCCCAGG - Intronic
950522535 3:13505473-13505495 GCGGCCCCCTGGAGGCGACAGGG - Exonic
951522395 3:23621759-23621781 GCGTCCCCAGGGAGAGGCTCTGG - Intergenic
961379264 3:126486745-126486767 GCGTCCCCTTGGAGTAGCCACGG + Intronic
962818172 3:139020823-139020845 CGGTCCCCCAGGAGGCGCCCCGG - Exonic
966881572 3:184353882-184353904 CCGTCCCCATGGATGGGCTCTGG - Intronic
980680590 4:136155097-136155119 TGGGCCCCATGGAGGTGCCCAGG + Intergenic
980930482 4:139178173-139178195 GCGGCCCCTTGGAGCTGCCCGGG + Intergenic
985667552 5:1189449-1189471 GGGTCCCCATGGCGGCCTCCTGG - Intergenic
991956982 5:72004888-72004910 AAGTCCCCATGAAGGCACCCAGG + Intergenic
994043679 5:95284907-95284929 GCGTCCCCCAGGCCGCGCCCTGG + Intergenic
1013177443 6:107689789-107689811 CTGTCCTCATGGAGGCACCCAGG + Intergenic
1013638301 6:112049213-112049235 GCCTCCCCATGCAGCAGCCCGGG - Intergenic
1018784684 6:167098824-167098846 GCGTGTCCATGGAGGAACCCAGG - Intergenic
1019478222 7:1254365-1254387 GCGTTCCCACGGTGGCCCCCCGG - Intergenic
1020066297 7:5190621-5190643 GCGTCCCCAGGGGCGGGCCCGGG + Intronic
1020118118 7:5487713-5487735 GGGGCCCCAGGCAGGCGCCCTGG + Intronic
1022096039 7:27142361-27142383 GCCTCCCGATCGGGGCGCCCGGG - Intronic
1023742207 7:43290778-43290800 GAGTGCCCATGGTGGGGCCCAGG + Intronic
1026665347 7:72336446-72336468 ACGTCCCCAGGCAGGCGGCCAGG + Intronic
1027421127 7:78019413-78019435 GCGACCCCCGGGGGGCGCCCCGG - Exonic
1035056600 7:156040220-156040242 GGGTCCCCAGGGACGCCCCCAGG - Intergenic
1035239437 7:157520272-157520294 GCTTCCTCCTGGAGGCGCCTGGG - Intergenic
1049497418 8:142942809-142942831 GCCTCCCCATGGGGGCTCCATGG - Intergenic
1053429500 9:38032808-38032830 TTGTCCCCATGGAGAGGCCCCGG + Intronic
1054855332 9:69893150-69893172 GCGAGCCCATGGAAGCGCCTAGG - Intronic
1056939827 9:90945674-90945696 CTGTCCCCATGGAGCTGCCCAGG + Intergenic
1061941740 9:133887597-133887619 GTGTCCCCAGGGAGGCGCGTGGG - Intronic
1062354911 9:136157394-136157416 CCGTCCCCATTTAGGAGCCCTGG + Intergenic
1062620108 9:137416815-137416837 GGGTGCTCTTGGAGGCGCCCCGG + Intronic
1185877599 X:3713239-3713261 GCGTCCCCATGGAGGCGCCCGGG - Exonic
1185894151 X:3843468-3843490 GCGTCCCCATGAAGGCGCCCGGG - Exonic
1185899270 X:3881892-3881914 GCGTCCCCATGAAGGCGCCCGGG - Intergenic
1185904387 X:3920321-3920343 GCGTCCCCATGAAGGCGCCCGGG - Intergenic
1199783180 X:151082037-151082059 CCGCCCCCATGGAGGAGCTCAGG + Intergenic
1200787707 Y:7274305-7274327 GCCTCCCCATGGAGGCGCCCGGG + Intergenic