ID: 1185877728

View in Genome Browser
Species Human (GRCh38)
Location X:3713669-3713691
Sequence CCCCGCGGCCGGGTTAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185877728_1185877743 29 Left 1185877728 X:3713669-3713691 CCCGCCCTAACCCGGCCGCGGGG 0: 1
1: 0
2: 2
3: 8
4: 127
Right 1185877743 X:3713721-3713743 CCCCCGCCCCGACCCAGCCCAGG 0: 1
1: 0
2: 21
3: 165
4: 1195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185877728 Original CRISPR CCCCGCGGCCGGGTTAGGGC GGG (reversed) Intergenic
900342238 1:2194677-2194699 CCCGGCGGGCGGGTGAGGCCGGG - Exonic
900894701 1:5475005-5475027 TCCCGCTGCCTGGTTGGGGCCGG - Intergenic
901109905 1:6785802-6785824 CCCCGGGGGCGGGCTGGGGCCGG + Intronic
907319437 1:53593565-53593587 CCCCAGGGCAGGGTTTGGGCTGG - Intronic
912480557 1:109979307-109979329 CCCCGGGGCCAGGTTGGGCCAGG + Intergenic
914919620 1:151838510-151838532 CCCCGCGGCCAGGCCTGGGCCGG - Exonic
915261850 1:154682383-154682405 CCACGGGGCTGGGTTAGGACAGG + Intergenic
915333177 1:155126164-155126186 CCCCGTGGCCGGGTCAGGGCCGG - Intergenic
916717064 1:167455278-167455300 CCCCGCGTCCGGCTTGGGGCCGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
1064354356 10:14604152-14604174 CCCCGGAGCCGGGGTCGGGCAGG + Intronic
1069894397 10:71671642-71671664 CCCTGCTGCCTGGATAGGGCAGG + Intronic
1069982260 10:72260838-72260860 CCCGGCGGCTGGGTGGGGGCAGG - Intergenic
1071979361 10:90988062-90988084 CCACCCGGCAGGGTTAGGGAGGG - Intergenic
1075375421 10:121974805-121974827 CCCCGCGCCCGGCGCAGGGCGGG + Intronic
1075545514 10:123351761-123351783 CACCTGGGCCGGGTTTGGGCCGG - Intergenic
1076850079 10:133088348-133088370 CGCCGCGGCCGGGCTGGGGCGGG + Intronic
1078266282 11:9758299-9758321 CCGCGCGCCCGGGTCGGGGCTGG - Intergenic
1083173480 11:60936064-60936086 CCCGGCGGCAGGGCTCGGGCGGG - Exonic
1083333526 11:61910191-61910213 CCCCGCTGCAGGGGAAGGGCAGG + Intronic
1084154085 11:67304080-67304102 CCCCAGGGCAGGGTGAGGGCGGG - Intronic
1084265507 11:68003503-68003525 CCCCGCGGCGGGGGTGGGGTTGG - Intronic
1084357464 11:68649835-68649857 CCCCGGGGCCGGGAAAGGGCCGG + Intergenic
1084575664 11:69986415-69986437 CCCCGGGGCTGGGCTGGGGCTGG + Intergenic
1084871757 11:72103219-72103241 CCCCATGGCCGGGGTCGGGCCGG + Exonic
1085784417 11:79438206-79438228 CCCCACGGCTGTGTCAGGGCTGG + Intronic
1091274734 11:134342554-134342576 CCCCGCGGCAGGGGAAGGGCAGG - Intronic
1091498278 12:991160-991182 CCCCGCGGCGGGGCTGGGGGCGG + Intronic
1096127701 12:49131550-49131572 CCCCGCGGCCGCGCGAGGGGAGG - Intergenic
1101083301 12:101210003-101210025 CCCCGAGGCGGGGTGAGGGCTGG + Exonic
1103325709 12:120118608-120118630 CCTCGCTGGCTGGTTAGGGCTGG - Intergenic
1103470451 12:121176174-121176196 CCCCTGGGCTAGGTTAGGGCTGG - Intronic
1104376136 12:128266981-128267003 CCCCCCGCCCGGGCTAGGGAGGG - Intergenic
1106517251 13:30465703-30465725 CCCCGCGGCCGGGAGCCGGCGGG - Intronic
1119841961 14:77800116-77800138 CCCCGCTACCGGGTTGCGGCCGG + Exonic
1121473376 14:94174018-94174040 TCCCGCAGCCGGCTGAGGGCGGG - Intronic
1122418257 14:101560598-101560620 GCCCGCGGGCGGGTTACCGCCGG - Intergenic
1122782482 14:104149538-104149560 CTCCGAGGCCTGGATAGGGCTGG + Intronic
1122993194 14:105248598-105248620 CCCCGCGGCCGGGCCTGGCCGGG + Exonic
1124545902 15:30626332-30626354 TCCGGCGGCCAGGCTAGGGCGGG + Exonic
1124779420 15:32615719-32615741 TCCGGCGGCCAGGCTAGGGCGGG + Exonic
1127849499 15:62900764-62900786 CACAGCGGCCGGGGGAGGGCTGG + Intergenic
1129197897 15:73982037-73982059 CCCCTTGGCTGGGGTAGGGCTGG - Exonic
1132701045 16:1222252-1222274 CCCCGGGGCCGGGATAGTCCCGG + Exonic
1132939060 16:2498096-2498118 CCCCGGCCCCGGTTTAGGGCCGG - Intronic
1133229167 16:4358356-4358378 CCCCGAGTCCGGGTGAGGGTGGG - Exonic
1137665381 16:50246329-50246351 CCGCGAGGCCGGGGAAGGGCGGG - Intronic
1137988760 16:53131404-53131426 TCCCGGGGCCGGGGTCGGGCGGG + Intronic
1141644575 16:85360358-85360380 CCCTGCGGCCGGGTGGGGGCAGG + Intergenic
1142349887 16:89575195-89575217 CCCCGAGGCCGGGGCGGGGCGGG - Intergenic
1142549963 17:732465-732487 CCCGGCGGCTGCGATAGGGCGGG - Exonic
1142550066 17:732816-732838 CCCCGCGGCCGGGTGGGGTGCGG - Intronic
1142847889 17:2690956-2690978 CCCCGAGGCCGGGTCAGGTGCGG - Intronic
1143095586 17:4476795-4476817 CCCAGGGGCTGGGTTAGGCCAGG + Intronic
1146008412 17:29176826-29176848 CCGCGCGGCGGCGTGAGGGCTGG - Intronic
1147636484 17:41967263-41967285 CCCCGCGCCCGGGTGCGGGCGGG + Intronic
1148060046 17:44830051-44830073 ACCCGCCGCCGGGTGAGGGGCGG - Intronic
1148135607 17:45289901-45289923 CCACGAGGCCTGGGTAGGGCCGG - Intronic
1149682209 17:58514475-58514497 CCCCGCAGCCGGGATGCGGCGGG - Intronic
1151678142 17:75610409-75610431 CCCTCCGGCCGGGGTAGGCCGGG + Intergenic
1152934667 17:83129027-83129049 GCCCGGGGCCGGGTCAGGCCAGG + Intergenic
1153765151 18:8367582-8367604 CCCCGCGGCCGGATGAAGCCGGG - Intronic
1160453548 18:78980492-78980514 CCCCGCGGCCGGCCTGGCGCGGG - Intronic
1160565944 18:79786637-79786659 CCCCGCGGACTGGTTTGAGCCGG + Intergenic
1160829197 19:1095073-1095095 CCCCGCTGCCGGCTCAGGTCGGG + Intronic
1160873069 19:1285805-1285827 CCGCGCGGCCGGGGCACGGCGGG + Intergenic
1160949327 19:1658030-1658052 CCCCGAGGCGGGGGCAGGGCAGG + Intergenic
1166219080 19:41353785-41353807 CCCCGCGGGCGGCTCAGAGCCGG + Exonic
1166623690 19:44329738-44329760 TCCCTCGGCCAGGTTTGGGCAGG - Exonic
1167074761 19:47241297-47241319 CCCCGCCCCCGGGGAAGGGCTGG + Intergenic
1167104538 19:47422221-47422243 CCCCCCGCCCGGGTCAGGCCGGG - Intergenic
927809199 2:26172734-26172756 CCCCGCGCCCAGGTGACGGCGGG - Intergenic
928093753 2:28392122-28392144 CCCTGCGGCCGGGTGTTGGCGGG - Intergenic
928186558 2:29115707-29115729 GCCGGCGGCGGGGTTGGGGCCGG + Intronic
933726670 2:85431018-85431040 CTCCTCGGCCAGGTTGGGGCAGG + Intronic
938581674 2:132652058-132652080 CACCACTGCCGGGTTAGGGTAGG + Intronic
948058203 2:235025232-235025254 CTCAGCGGCAGGGTGAGGGCGGG + Intronic
1172099238 20:32475493-32475515 CCTCGCTGCCGGCTTCGGGCCGG + Intronic
1175983834 20:62754527-62754549 CCGGGCAGCCGGGATAGGGCCGG + Intronic
1176306859 21:5128213-5128235 CCCCGCGGCCAGGGTCGCGCTGG - Exonic
1179850198 21:44133817-44133839 CCCCGCGGCCAGGGTCGCGCTGG + Exonic
1181057810 22:20268193-20268215 TCCCGCGGCCGGGCCGGGGCCGG - Exonic
1184562208 22:45269613-45269635 TCCCCCGGCCGGGATGGGGCTGG + Intergenic
1185338028 22:50279479-50279501 CCCTGAGGCCGAGTTAGAGCAGG + Intronic
965757571 3:172040725-172040747 GCCCGCGGCTGGGCTGGGGCCGG + Intronic
967884796 3:194325952-194325974 CCCCGGGGCTGGGGAAGGGCCGG - Intergenic
968051491 3:195658020-195658042 CACCACGGCCGGGTCAAGGCGGG - Intergenic
968104327 3:195990313-195990335 CACCACGGCCGGGTCAAGGCGGG + Intergenic
968302623 3:197627903-197627925 CACCACGGCCGGGTCAAGGCGGG + Intergenic
968642575 4:1721822-1721844 CCCGGCGGTCGGTCTAGGGCCGG - Intronic
969379139 4:6782882-6782904 CCCCTCGGCCGGGTGGGCGCGGG + Intronic
970456061 4:16226023-16226045 CCCCGCGGCCGCGCCAGGCCAGG - Intronic
973279254 4:48341875-48341897 CCCGGCAGCCCGGTTCGGGCCGG + Exonic
975410121 4:74039005-74039027 CCCCGCGTACGGGGTAGGGTTGG + Intergenic
975848941 4:78552004-78552026 CCACGCAGCTGGGTTGGGGCCGG - Intronic
981061312 4:140427793-140427815 CCCCGCTCCCGGGTTAGCCCAGG + Exonic
981315420 4:143336285-143336307 CCCGGCGGCCGGGAGAGGGAGGG + Intergenic
984639272 4:182144539-182144561 CCGCGCGGCCGGGGGCGGGCAGG + Intronic
985673504 5:1218498-1218520 GCCAACGGCCGGGTTAGAGCAGG - Intronic
994366995 5:98928422-98928444 CCCAGCGGCCGGGTGAAGGCCGG - Intronic
1002424341 5:179166627-179166649 TCCCGCGGCCAGGATGGGGCTGG - Intronic
1002591021 5:180291820-180291842 CCCGGCGGGCGGGCTAGGCCTGG - Intronic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1007614527 6:43172194-43172216 CCCCGGGGCCCGGTTGGGGTGGG + Intronic
1007625383 6:43243620-43243642 CCCCGGGGCCGGGGCGGGGCGGG - Intergenic
1013369269 6:109455667-109455689 CCCCGCGGCCGGGTGGGGTGAGG - Intronic
1018394481 6:163367106-163367128 ACCCCGGGCCAGGTTAGGGCTGG - Intergenic
1019784869 7:2968956-2968978 GCCCGCGACAGGGTTAGGCCAGG + Intronic
1020009035 7:4798607-4798629 CCTCCTGCCCGGGTTAGGGCCGG + Intronic
1027244698 7:76359092-76359114 AGCCGCGGCCGGGCTCGGGCGGG - Intergenic
1031604207 7:123748950-123748972 CCGCCCGGCCAGGCTAGGGCCGG + Exonic
1031689159 7:124766178-124766200 CCCCGAGCCCGGGCTAGGGGCGG + Intergenic
1033219492 7:139518928-139518950 CACCGCGCCCGGCCTAGGGCGGG + Intergenic
1034228045 7:149497877-149497899 CCCCGCGGGCGGGGCTGGGCGGG - Intergenic
1034425868 7:151013698-151013720 CGGGGCGGCGGGGTTAGGGCGGG - Intronic
1034617917 7:152435507-152435529 CCCCCCGGCGGGGTGGGGGCGGG - Intronic
1035233816 7:157483852-157483874 CCCCGCGTGCGGGTGAGGGGGGG + Intergenic
1037336884 8:17801008-17801030 CCCGGCGGCCGGGGTGGGGAGGG - Intergenic
1039996894 8:42541777-42541799 CCCCGCGTCCGGGGCGGGGCGGG - Intronic
1045547275 8:103140539-103140561 CCCCGCAGCCGGAGGAGGGCTGG - Intronic
1049639359 8:143707631-143707653 GCCCGCGGCCGGGGTGAGGCGGG - Intronic
1050276967 9:4010122-4010144 CCCCGGGGTGGGGTGAGGGCAGG + Intronic
1057208031 9:93184812-93184834 CTCCGCGGCCGGGGCTGGGCAGG + Intergenic
1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG + Intronic
1060263023 9:122092658-122092680 CCACGCGGCCGGGTCGGGCCGGG + Intronic
1061057656 9:128232921-128232943 CCCCGAGGCAGGGCTGGGGCAGG - Intronic
1061559526 9:131393917-131393939 CCCGGGGGCCGGGCGAGGGCTGG - Intergenic
1061971682 9:134048683-134048705 CCCCTCGCCCAGGTGAGGGCGGG - Intronic
1062295190 9:135821370-135821392 CCCCCCGGCTGGGTCAAGGCCGG - Exonic
1062490030 9:136800499-136800521 CCCAGCGGCCCGGGAAGGGCGGG + Exonic
1062525673 9:136977210-136977232 CCCAGCGGCCCTGATAGGGCAGG - Intergenic
1185466667 X:358931-358953 CACCGCGGCGGGGGTAGGGGAGG + Intronic
1185477130 X:422032-422054 ACCTGCGGCCGGGTTGGGGTGGG + Intergenic
1185877728 X:3713669-3713691 CCCCGCGGCCGGGTTAGGGCGGG - Intergenic
1187826286 X:23335261-23335283 CGCCGCGGCCGCGGTCGGGCTGG + Intronic
1198750451 X:139932627-139932649 CACGGCGGACGAGTTAGGGCCGG - Intronic
1200083046 X:153588868-153588890 CCCAGGGGCTGGGTTAGGGTAGG - Intronic
1200787604 Y:7273902-7273924 CCCCGCGGCCGGGTGGGGGCGGG + Intergenic