ID: 1185877868

View in Genome Browser
Species Human (GRCh38)
Location X:3714230-3714252
Sequence GGTCCCAAACAAGCACCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185877868_1185877872 -2 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877872 X:3714251-3714273 CCTGAGAGAATTTGGAATGAGGG No data
1185877868_1185877869 -10 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877869 X:3714243-3714265 GTTTGGGACCTGAGAGAATTTGG No data
1185877868_1185877876 15 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877876 X:3714268-3714290 TGAGGGCGGATCCCCAAGAGGGG No data
1185877868_1185877877 22 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877877 X:3714275-3714297 GGATCCCCAAGAGGGGCTGCCGG No data
1185877868_1185877878 23 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877878 X:3714276-3714298 GATCCCCAAGAGGGGCTGCCGGG No data
1185877868_1185877874 13 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877874 X:3714266-3714288 AATGAGGGCGGATCCCCAAGAGG No data
1185877868_1185877882 30 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877882 X:3714283-3714305 AAGAGGGGCTGCCGGGTCTTCGG No data
1185877868_1185877875 14 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877875 X:3714267-3714289 ATGAGGGCGGATCCCCAAGAGGG No data
1185877868_1185877870 -3 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877870 X:3714250-3714272 ACCTGAGAGAATTTGGAATGAGG No data
1185877868_1185877873 1 Left 1185877868 X:3714230-3714252 CCTGCGGGTGCTTGTTTGGGACC No data
Right 1185877873 X:3714254-3714276 GAGAGAATTTGGAATGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185877868 Original CRISPR GGTCCCAAACAAGCACCCGC AGG (reversed) Intergenic
No off target data available for this crispr