ID: 1185880595

View in Genome Browser
Species Human (GRCh38)
Location X:3736405-3736427
Sequence TGGTCTTTTACCCATGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185880591_1185880595 3 Left 1185880591 X:3736379-3736401 CCACATGGGACTGTTTGTGCCAT No data
Right 1185880595 X:3736405-3736427 TGGTCTTTTACCCATGTGGTTGG No data
1185880585_1185880595 21 Left 1185880585 X:3736361-3736383 CCCCTTGGGGCGGTCTTCCCACA No data
Right 1185880595 X:3736405-3736427 TGGTCTTTTACCCATGTGGTTGG No data
1185880586_1185880595 20 Left 1185880586 X:3736362-3736384 CCCTTGGGGCGGTCTTCCCACAT No data
Right 1185880595 X:3736405-3736427 TGGTCTTTTACCCATGTGGTTGG No data
1185880587_1185880595 19 Left 1185880587 X:3736363-3736385 CCTTGGGGCGGTCTTCCCACATG No data
Right 1185880595 X:3736405-3736427 TGGTCTTTTACCCATGTGGTTGG No data
1185880590_1185880595 4 Left 1185880590 X:3736378-3736400 CCCACATGGGACTGTTTGTGCCA No data
Right 1185880595 X:3736405-3736427 TGGTCTTTTACCCATGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185880595 Original CRISPR TGGTCTTTTACCCATGTGGT TGG Intergenic
No off target data available for this crispr