ID: 1185886132

View in Genome Browser
Species Human (GRCh38)
Location X:3784999-3785021
Sequence GTCCCCAGGGACCATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185886132_1185886136 -2 Left 1185886132 X:3784999-3785021 CCCTCATCATGGTCCCTGGGGAC No data
Right 1185886136 X:3785020-3785042 ACACTGACTATAGACTCCAATGG No data
1185886132_1185886137 -1 Left 1185886132 X:3784999-3785021 CCCTCATCATGGTCCCTGGGGAC No data
Right 1185886137 X:3785021-3785043 CACTGACTATAGACTCCAATGGG No data
1185886132_1185886139 20 Left 1185886132 X:3784999-3785021 CCCTCATCATGGTCCCTGGGGAC No data
Right 1185886139 X:3785042-3785064 GGTAGAAACAGCATCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185886132 Original CRISPR GTCCCCAGGGACCATGATGA GGG (reversed) Intergenic
No off target data available for this crispr