ID: 1185889045

View in Genome Browser
Species Human (GRCh38)
Location X:3808206-3808228
Sequence CACGGTGACAAAAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185889038_1185889045 13 Left 1185889038 X:3808170-3808192 CCTGGTTGGCACTATGTTGCCTG No data
Right 1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG No data
1185889041_1185889045 -6 Left 1185889041 X:3808189-3808211 CCTGTTCCTTTAAGGTACACGGT No data
Right 1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185889045 Original CRISPR CACGGTGACAAAAGGGAAGA TGG Intergenic
No off target data available for this crispr