ID: 1185890313

View in Genome Browser
Species Human (GRCh38)
Location X:3816351-3816373
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185890293_1185890313 24 Left 1185890293 X:3816304-3816326 CCTAGAGGAGCCGTCAGCCTTCC No data
Right 1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG No data
1185890301_1185890313 3 Left 1185890301 X:3816325-3816347 CCAGGGAAGGCACCTGGCCGGTC No data
Right 1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG No data
1185890305_1185890313 -9 Left 1185890305 X:3816337-3816359 CCTGGCCGGTCGGGGAGACTCCC No data
Right 1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG No data
1185890297_1185890313 14 Left 1185890297 X:3816314-3816336 CCGTCAGCCTTCCAGGGAAGGCA No data
Right 1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG No data
1185890299_1185890313 7 Left 1185890299 X:3816321-3816343 CCTTCCAGGGAAGGCACCTGGCC No data
Right 1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG No data
1185890292_1185890313 27 Left 1185890292 X:3816301-3816323 CCTCCTAGAGGAGCCGTCAGCCT No data
Right 1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185890313 Original CRISPR GAGACTCCCCGGGGCTGCGG GGG Intergenic