ID: 1185890769

View in Genome Browser
Species Human (GRCh38)
Location X:3819912-3819934
Sequence AAACTCTGTATTTGCAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185890761_1185890769 27 Left 1185890761 X:3819862-3819884 CCCTGGAGCTTAAAGACTTCTCT 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1185890769 X:3819912-3819934 AAACTCTGTATTTGCAAGGCGGG 0: 2
1: 0
2: 1
3: 15
4: 165
1185890762_1185890769 26 Left 1185890762 X:3819863-3819885 CCTGGAGCTTAAAGACTTCTCTC 0: 1
1: 0
2: 4
3: 15
4: 172
Right 1185890769 X:3819912-3819934 AAACTCTGTATTTGCAAGGCGGG 0: 2
1: 0
2: 1
3: 15
4: 165
1185890766_1185890769 -4 Left 1185890766 X:3819893-3819915 CCTCAGGAGGTCTTTTATCAAAC 0: 1
1: 0
2: 0
3: 6
4: 129
Right 1185890769 X:3819912-3819934 AAACTCTGTATTTGCAAGGCGGG 0: 2
1: 0
2: 1
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185890769 Original CRISPR AAACTCTGTATTTGCAAGGC GGG Intronic
907743695 1:57191567-57191589 AAACTTTCTATTTGCAAGGAGGG - Intronic
908131404 1:61079463-61079485 AAACACAGTAAATGCAAGGCTGG + Intronic
908186662 1:61658891-61658913 AAAATCTGCATCTACAAGGCTGG + Intergenic
911910786 1:103631791-103631813 AAATTCTCTATCTGAAAGGCTGG + Intergenic
911918201 1:103725916-103725938 AAATTCTCTATCTGAAAGGCTGG + Intronic
914216443 1:145634527-145634549 AAAATGTGTATTTTCAAGGTGGG + Intronic
914469014 1:147957185-147957207 AAAATGTGTATTTTCAAGGTGGG + Intronic
915694636 1:157726964-157726986 AAACTGTGTATTTTCAGAGCAGG + Intergenic
917202776 1:172534152-172534174 AAATGCTGTATTTTCAAGGCGGG + Intronic
920118419 1:203637642-203637664 AAAGTCTGGATTGGCAAGGAGGG - Intronic
921156652 1:212444321-212444343 AAACTCTGTAGTGGGAAGGAAGG - Exonic
921411551 1:214841511-214841533 AATCTCTGCACTTGCAAAGCTGG - Intergenic
921916305 1:220614302-220614324 GAACTGTGTATTTGAAAAGCAGG - Intronic
923797963 1:237177926-237177948 ATAATCTGTATTTGCTAGCCTGG - Intronic
1067928704 10:50538096-50538118 AATCTCTGTATTTCCAGAGCAGG - Intronic
1069558864 10:69415771-69415793 AAACTATGAATCTGGAAGGCAGG - Intronic
1072465916 10:95662393-95662415 AATCTCTGAATTGGCAGGGCAGG + Intergenic
1073487065 10:103826170-103826192 AAACTCTGGATGTGCAAAGCAGG - Intronic
1073651614 10:105366580-105366602 AACCTCTGTATTAGGCAGGCAGG + Intergenic
1074254399 10:111785699-111785721 AATCTCTTTATTTGCTTGGCGGG - Intergenic
1074281322 10:112054278-112054300 AAACTCTGTTTCTGCAAGGAAGG - Intergenic
1080286634 11:30621811-30621833 AAACGCTGAATATGGAAGGCAGG + Intergenic
1083024117 11:59535386-59535408 AGAATCTGTATTTCTAAGGCTGG + Intergenic
1083164095 11:60873002-60873024 ATACTCAGCATTTCCAAGGCAGG - Intronic
1084454151 11:69257764-69257786 TGACTCTGGCTTTGCAAGGCAGG - Intergenic
1089616196 11:119696252-119696274 AAAGTCTGTCTTTGGAGGGCAGG + Intronic
1093566634 12:20614143-20614165 AAACTGTGTATTGGAAAGTCAGG - Intronic
1093624879 12:21333344-21333366 AATCTCTGTATTTATAAAGCTGG + Intronic
1094942006 12:35780825-35780847 AAACACTGTGTTTGCAATGTCGG + Intergenic
1095433454 12:42160532-42160554 AATCTGTGTATTTGCATGGTAGG + Exonic
1098306367 12:69106772-69106794 AAACTAGTTATTGGCAAGGCAGG - Intergenic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1099282805 12:80673976-80673998 AAATTCTTTATTTGTAAGGCAGG + Intronic
1104552985 12:129774406-129774428 CAACTCTGTGTTTGCCAGGAAGG + Intronic
1107897237 13:44977298-44977320 AAGCTATGTATTTGCAAAGGAGG + Intronic
1108422165 13:50262062-50262084 AAATTCTGTTTTTGGAAAGCTGG + Intronic
1109033050 13:57218439-57218461 AGAATCTGTATTTCCAAAGCTGG - Intergenic
1109575324 13:64249332-64249354 AAACTCTCTACTTGCCAGACTGG - Intergenic
1109738145 13:66514121-66514143 GAACTCTATATTTGCAAACCTGG + Intronic
1112141391 13:96647547-96647569 AAATTTTGTATTAGCAAGTCTGG + Intronic
1113013300 13:105795741-105795763 AAACTCTGTATTTGCATACTAGG - Intergenic
1113088079 13:106588556-106588578 AAAGCCTGCATTTGCAAAGCTGG + Intergenic
1120397518 14:83986423-83986445 AACCTCTGTATTTCCATGTCAGG - Intergenic
1120718292 14:87863729-87863751 AATATCTCTATTTGCCAGGCTGG - Intronic
1121341866 14:93110233-93110255 AAAGTGTTCATTTGCAAGGCTGG + Intronic
1122091449 14:99343573-99343595 GAAGCATGTATTTGCAAGGCTGG - Intergenic
1122099716 14:99397892-99397914 AAACTCTCCATTACCAAGGCTGG + Exonic
1125365181 15:38905846-38905868 AAACTCAACATTTGTAAGGCAGG + Intergenic
1126457606 15:48881060-48881082 AAATTCTGATTTTGCAAGGTAGG + Intronic
1127264107 15:57347283-57347305 ATACACAGTATTTTCAAGGCAGG - Intergenic
1128715116 15:69902140-69902162 GAACTCTGCATTTCCAAGTCAGG + Intergenic
1130171679 15:81521059-81521081 AAACTCTATCTTTGCCTGGCTGG + Intergenic
1133604926 16:7377544-7377566 GGAATCTGTATTTGCAGGGCAGG + Intronic
1134228982 16:12414749-12414771 AGACTCTGTGTCTCCAAGGCTGG + Intronic
1137828739 16:51523934-51523956 TATCTCTGTTTTTGGAAGGCAGG - Intergenic
1140975383 16:80055244-80055266 AAACAAAGTTTTTGCAAGGCAGG + Intergenic
1143073410 17:4317487-4317509 TCACTCTGTATTTCCCAGGCTGG - Intronic
1143826357 17:9611128-9611150 AAACACTGTATTTCCCATGCTGG + Intronic
1144811501 17:18002834-18002856 TAACTCTGAAGTTGTAAGGCAGG + Intronic
1147045769 17:37750966-37750988 AAACTCTGCATTTCGAAGGAAGG - Intergenic
1149058401 17:52391699-52391721 AGACTCTCTATTTGCAAGCTTGG - Intergenic
1149089167 17:52757793-52757815 AAACTCTGTGTCTTCATGGCAGG + Intergenic
1149296817 17:55268311-55268333 AAATTCTGATTTTGCAAGTCTGG + Intronic
1150641034 17:66949526-66949548 AAAATCTGAATTTGCAAGGAGGG + Intergenic
1151082579 17:71345629-71345651 AAACTCTGTATTACCATGCCTGG + Intergenic
1155994665 18:32318021-32318043 AAACTCTGTTCTTGAAAGGGAGG + Intronic
1156104184 18:33636966-33636988 ATACTATGTATTTGCAATACAGG - Intronic
1156859835 18:41823029-41823051 AAACTAATTATTTGCAAAGCTGG - Intergenic
1159916187 18:74189781-74189803 AAACTGTGAATTTGCAAAGGAGG - Intergenic
1160410146 18:78670232-78670254 AAATTCTTTATCTGCAAGGCTGG + Intergenic
1161066188 19:2239067-2239089 AAAATCTGTATTTGTAGGCCGGG + Intronic
1163464654 19:17460305-17460327 CAACTATGTAATAGCAAGGCCGG - Intronic
1168037922 19:53735078-53735100 AAAATCTGTATTTTCCAGGCTGG + Intergenic
926038993 2:9657615-9657637 AAACTTTGTTTTGGGAAGGCTGG - Intergenic
927950048 2:27161303-27161325 CTACTCTGTTTTTGGAAGGCAGG - Intergenic
928211102 2:29324538-29324560 AAACACTGTTTTTGCCTGGCAGG + Intronic
928796539 2:35028909-35028931 AAATTCTGTTTTTGAAAGCCTGG + Intergenic
931455789 2:62408961-62408983 AAACTCTGTTTTAGCCAGGTAGG - Intergenic
932792819 2:74670761-74670783 ACCCTCTGTATTTCCAAGGGGGG - Intronic
933666565 2:84970293-84970315 AAACTCCAAATTTTCAAGGCAGG + Intergenic
933912225 2:86951714-86951736 AAAAACTGTAATTGTAAGGCAGG + Intronic
934010769 2:87818183-87818205 AAAAACTGTAATTGTAAGGCAGG - Intronic
934315741 2:91917997-91918019 ATACTCTAACTTTGCAAGGCTGG - Intergenic
936113242 2:109682378-109682400 ATACTCTGTATTTGCTAGATGGG + Intergenic
937418219 2:121734090-121734112 AAACACTGTTTTGGCCAGGCTGG - Intronic
937694470 2:124792467-124792489 AAGCTCTGTATTTGAAACGATGG - Intronic
938625968 2:133110047-133110069 AACCTCTGTTGCTGCAAGGCTGG - Intronic
939285993 2:140130306-140130328 AAAATCTGTATATTCATGGCCGG - Intergenic
940567902 2:155391583-155391605 AAACTCTTTATTTCAATGGCAGG - Intergenic
940789642 2:158018610-158018632 AATCTCTCTATTTGGAAAGCAGG + Intronic
942530196 2:176901804-176901826 CAACCCTGTATCTGCAAGGCAGG + Intergenic
944666793 2:201965495-201965517 GAAGTGTCTATTTGCAAGGCGGG + Intergenic
944842615 2:203638895-203638917 AGACTCTGTCTTGGCCAGGCAGG - Intergenic
945256930 2:207810824-207810846 AAATGCTGTATTTCCAGGGCTGG - Intergenic
948122066 2:235538227-235538249 AAAATCTGAATTTCCAGGGCAGG + Intronic
1172123145 20:32610268-32610290 AAAGGTTGTATTTGAAAGGCTGG - Intergenic
1173921469 20:46749324-46749346 AATCTCTGGATTTGACAGGCTGG + Intergenic
1174234682 20:49079724-49079746 AAAATCTGTATGTGGAAGGCTGG - Intronic
1174466542 20:50722077-50722099 AATCTATGTATTGGCAAGGTTGG - Intergenic
1174602165 20:51733701-51733723 AAAATCTGTATTACCCAGGCTGG + Intronic
1174654859 20:52162745-52162767 ACACTGTGTATTTGCAACACTGG + Intronic
1177439696 21:21105679-21105701 AAACTCTTCATTGGCAAGACTGG + Intronic
1178708304 21:34891192-34891214 AAACTCGGTGCATGCAAGGCTGG - Intronic
1178879158 21:36434849-36434871 AAAGTCTGGATTTGTCAGGCAGG - Intergenic
1179267163 21:39813792-39813814 TCACTCAGTATTTGCAAGGCTGG - Intergenic
1180026637 21:45167453-45167475 AAACTTTTTATTTTGAAGGCTGG + Intronic
1182100134 22:27651767-27651789 TAACTATGTATCTGCAAGGCTGG - Intergenic
1182728013 22:32463945-32463967 AATCTCTGTGCTTTCAAGGCAGG - Intronic
1184310119 22:43635843-43635865 CACTTCAGTATTTGCAAGGCAGG - Intronic
1185235841 22:49712438-49712460 AAACTCTGGTTTGGGAAGGCTGG - Intergenic
949733020 3:7136253-7136275 AAACACTGTATTTGCTATGTGGG + Intronic
952387998 3:32856773-32856795 AATCACAGTGTTTGCAAGGCAGG - Intronic
955799640 3:62672330-62672352 TAACTCAGGCTTTGCAAGGCAGG + Intronic
957215181 3:77311367-77311389 AAACTGTATATTTGCAAAACTGG + Intronic
957301504 3:78397567-78397589 AAACTCAGTATTTCCAAATCTGG - Intergenic
960684559 3:120284040-120284062 AAGCACTGTTTTTGCAAGCCGGG + Intronic
960832944 3:121869679-121869701 AGACTCTGTATTGCCTAGGCTGG - Intronic
961416197 3:126759199-126759221 ACACTCTGGCTTTGGAAGGCAGG - Intronic
962035343 3:131645597-131645619 AAACTCTGTATTTGAAACTTTGG - Intronic
962724801 3:138213612-138213634 AAGCTCAGAATTTGCAATGCAGG - Intronic
964518114 3:157534466-157534488 AAACTATGTAATTCCAAAGCTGG + Intergenic
966081006 3:176000421-176000443 AAACTGTGAATTTGCAAGTAGGG + Intergenic
967918037 3:194593473-194593495 ATACCCCATATTTGCAAGGCAGG - Intronic
974245737 4:59315146-59315168 AAAAGCTGTATCTGCAGGGCAGG - Intergenic
978130494 4:105190342-105190364 AAACTCTGTCTTCTCTAGGCTGG + Exonic
978955333 4:114606036-114606058 AAATTCTGAATTTGCAAAACAGG - Intronic
979081367 4:116348024-116348046 AAAGTCTAAGTTTGCAAGGCTGG + Intergenic
982895361 4:160915173-160915195 ATTCTCTGTATTTTCAAGGTGGG - Intergenic
983456416 4:167969797-167969819 TATCTCTGTTTCTGCAAGGCTGG - Intergenic
984096301 4:175439225-175439247 AAATGCTGTATTGCCAAGGCTGG + Intergenic
986271403 5:6234059-6234081 AAGTTCTGTTTTTGGAAGGCTGG + Intergenic
987822591 5:22984849-22984871 GAATTCAGTAGTTGCAAGGCTGG + Intergenic
988464873 5:31479421-31479443 AAACTCAGTATTTTCAACGTGGG - Intronic
990518594 5:56554886-56554908 AAACTCTTTACTTGTAAGGATGG + Intronic
992117050 5:73548881-73548903 AAATTCTGTACATGCAAGGTTGG + Intergenic
997977233 5:138447617-138447639 AAACTGAGTATTGCCAAGGCTGG + Intergenic
1000170541 5:158698942-158698964 AATTTCAGTATTTGCAAGGTCGG + Exonic
1003511682 6:6786307-6786329 AAGCTCTGTGTTTTCAAGGTTGG - Intergenic
1004046299 6:12027157-12027179 TAACTCTCTATTTCCCAGGCAGG - Intronic
1004459665 6:15824057-15824079 AAAGTCTGTATGTGGAAGGCAGG - Intergenic
1005592787 6:27346513-27346535 AAACTATGTATGTGCTAGGCCGG + Intergenic
1005833580 6:29690467-29690489 AAACTCTGTCTTAAAAAGGCCGG - Intergenic
1010556927 6:77293757-77293779 AAATTCTGTATTTCAAATGCTGG - Intergenic
1011978677 6:93342234-93342256 AAACTCTGTAATTGCAGGTGTGG + Intronic
1012539355 6:100342871-100342893 AAATGCTGTCCTTGCAAGGCTGG + Intergenic
1013268314 6:108521737-108521759 AAACTCTGTCTCTGTGAGGCTGG - Intronic
1015609551 6:135001261-135001283 AAACTCTGTAAGTACAATGCAGG - Intronic
1015825841 6:137310901-137310923 AAAGACTTTCTTTGCAAGGCAGG + Intergenic
1016769785 6:147836127-147836149 AACCCCAGTATTTTCAAGGCAGG + Intergenic
1020767571 7:12343461-12343483 AAAAGCTCTATTTGTAAGGCAGG - Intronic
1022137791 7:27465811-27465833 GAACTCTGTATTTGAAAGAGTGG - Intergenic
1022268124 7:28778958-28778980 GAACTCTGTCTTGGCATGGCGGG - Intronic
1022488219 7:30796611-30796633 AAACCCTTTATTTGGCAGGCGGG + Intronic
1022783727 7:33613942-33613964 ACACTCTGTTTCTGCATGGCAGG + Intergenic
1025010718 7:55395653-55395675 AAACTCTTTATATGCTAGACTGG - Intronic
1026442399 7:70455868-70455890 AAACTGTGTATTTGCCAGGCAGG - Intronic
1027310501 7:76949771-76949793 AAACTCTGTTGTTGCAACACAGG + Intergenic
1029686607 7:102152843-102152865 ACACTCTGCAGTTGCAGGGCAGG - Intronic
1031636922 7:124112679-124112701 AAACTAAGGAATTGCAAGGCAGG + Intergenic
1037084592 8:14832812-14832834 AAACATTGTATTTGAAAGGTTGG - Intronic
1040601000 8:48883795-48883817 CAACTCTGTATTTTCTCGGCTGG - Intergenic
1040900958 8:52416608-52416630 AAAATCTTTATTTACAAGACAGG - Intronic
1041813765 8:61942839-61942861 AAAATCTTTATTTTCAAGACTGG - Intergenic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1043500199 8:80846375-80846397 AATCTCTGTATTTAAAAAGCTGG - Intronic
1047408988 8:124608853-124608875 AGACTCTGTATTTGCTACCCTGG + Intronic
1047904208 8:129455355-129455377 AATCTCTTTATTTTCAAGGCTGG - Intergenic
1052113853 9:24624631-24624653 AATCTCTGTAATAGCAAGGGTGG - Intergenic
1053286607 9:36853515-36853537 AAACTTTGAATTTGCAGGTCAGG - Intronic
1053892395 9:42706964-42706986 AACCTCTGAATTTGTCAGGCAGG + Intergenic
1055302475 9:74896748-74896770 AAACTCTGCCTTTGCATGGGAGG - Intergenic
1057517522 9:95734686-95734708 AAACACTGCATCTGCAAGGAAGG + Intergenic
1059499136 9:114736006-114736028 AGCCTCTGTATTTGGCAGGCTGG + Intergenic
1060360025 9:122946536-122946558 AAAATCTGTACTAGCAAGTCAGG + Intronic
1185890769 X:3819912-3819934 AAACTCTGTATTTGCAAGGCGGG + Intronic
1185890917 X:3821341-3821363 AAACTCTGTATTTGCAAGGCGGG + Intronic
1189572525 X:42313587-42313609 AAACTCTCTAATTAAAAGGCAGG - Intergenic
1191953313 X:66617761-66617783 AACCTCTGTCTAGGCAAGGCAGG + Intronic
1196616061 X:117768860-117768882 AACCTCTGTAGTCCCAAGGCAGG + Intergenic
1197541140 X:127763376-127763398 AAACTATATACTTGCAAGGGAGG + Intergenic
1198439745 X:136651579-136651601 AAACCCTTTCTTTGCAAGACTGG + Intronic
1201718391 Y:17071858-17071880 AAACTCTGTGTTTGAGAAGCCGG + Intergenic
1201894342 Y:18977634-18977656 AAACTGTATATTTCCAAGGTGGG - Intergenic