ID: 1185891753

View in Genome Browser
Species Human (GRCh38)
Location X:3828266-3828288
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 3, 1: 0, 2: 3, 3: 54, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185891753 Original CRISPR CAGGGACAAGGGGCCGGGGT AGG (reversed) Intronic
900102480 1:967753-967775 CAGGGAGAGGGAGCCGGGCTGGG + Intronic
900158831 1:1213923-1213945 CAGGGACTGGGGGCTGGGGCAGG - Intronic
900245543 1:1634483-1634505 CAGGGCCAGGTAGCCGGGGTAGG - Exonic
900256772 1:1701640-1701662 CAGGGCCAGGTAGCCGGGGTAGG - Intronic
900431845 1:2606412-2606434 CACCGACAAGGGGCCGGGCTGGG - Intronic
900550287 1:3251178-3251200 CAGGTCCAAAGGGCAGGGGTGGG - Intronic
900655381 1:3754282-3754304 CAGAGTCGAGGGGCCGGGGGAGG + Intronic
901631798 1:10651614-10651636 CAGGGACACGAGGCCAGGCTGGG + Intronic
901640276 1:10689526-10689548 CAGGGAAAAAGGGCCAGGGGTGG + Intronic
901647547 1:10724734-10724756 CAGGGGCAAGGGCCCTGGGAGGG + Intronic
902372685 1:16015987-16016009 CAGGGACATGGGGAAGAGGTGGG + Intronic
902928444 1:19713391-19713413 CAGGAAGAAGGGGAAGGGGTGGG + Intronic
903021121 1:20395895-20395917 TAGGGAAGAGGGGCAGGGGTGGG + Intergenic
903773375 1:25778059-25778081 CAGGGAGAAGGGGCGTGGGAGGG - Intronic
905504476 1:38466168-38466190 TAGGGACAAGAGGCCGGGCATGG - Intergenic
907268632 1:53277430-53277452 CAGGGACCAGGGTCTGGGGTTGG + Intronic
907303483 1:53502008-53502030 GAGGGACAAGGGGCCTGGGGTGG + Intergenic
907303531 1:53502195-53502217 GAGGGACAAGGAGGCGGGGGAGG + Intergenic
907439638 1:54471280-54471302 CAGAGAAGAGGGGCTGGGGTGGG + Intergenic
907526187 1:55055465-55055487 CACAGAGAAGGGCCCGGGGTTGG + Intronic
907757106 1:57321362-57321384 CAGAGAGAAGGGGCCATGGTGGG - Intronic
908539882 1:65112190-65112212 CAGGAACAAGGGGGTGGGGGAGG + Intergenic
910597208 1:88992818-88992840 CGGGAACAAGGGGGCGGGGCGGG + Exonic
911166256 1:94727231-94727253 GAGGGACCATGGGCGGGGGTGGG - Intergenic
911296837 1:96128043-96128065 CAGGGAAATGGGGCCGGGCATGG + Intergenic
912417202 1:109517588-109517610 CAGGGGCAAGGGGCTGGGGGAGG + Intergenic
913099870 1:115553337-115553359 CAGGGACAAGGGGAGGCGGTGGG + Intergenic
913248112 1:116888124-116888146 CAGGGATAAGGGGAAGGGGAGGG + Intergenic
913683464 1:121209023-121209045 CAGGGAAAAGGGGCTGAGGGAGG - Intronic
914004912 1:143724027-143724049 CAGGGACAAGGTGTAGGGGCAGG + Intergenic
914035305 1:143996647-143996669 CAGGGAAAAGGGGCTGAGGGAGG - Intergenic
914154148 1:145071323-145071345 CAGGGAAAAGGGGCTGAGGGAGG + Intronic
914225432 1:145716095-145716117 CAGGGACTCAGGGCAGGGGTGGG - Intergenic
915641153 1:157227613-157227635 CAGGGCCAAGGGGTAGGGGGAGG + Intergenic
915668338 1:157465335-157465357 CAGGGCCAAGGGGCAGGGGGAGG - Intergenic
915880381 1:159664888-159664910 CAGGGACAAAGGGGTGAGGTAGG - Intergenic
917041075 1:170807116-170807138 CAGGAAGAAGGGGCCCAGGTTGG + Intergenic
917534255 1:175863197-175863219 CAGGGACAAAGGGCGGGGGTGGG - Intergenic
918265176 1:182835832-182835854 CACGGACCAGGGGCCTGGGAGGG + Intergenic
919122302 1:193356411-193356433 CAGGGATAAGGGCCTGAGGTGGG - Intergenic
919764223 1:201115753-201115775 CAAGGACCAGGCGCTGGGGTGGG - Exonic
920114067 1:203607486-203607508 CAGGAAAGAGGGGCTGGGGTGGG + Intergenic
920195322 1:204222672-204222694 CAGGGGCAGGGGGCCAGGGTGGG + Exonic
920470772 1:206227532-206227554 CAGGGAAAAGGGGCTGAGGGAGG - Intronic
921918583 1:220641767-220641789 CAAGGAAAAGCGGCAGGGGTGGG + Intronic
922156092 1:223040648-223040670 CATGGGCAAGGGGCAGGGGGAGG + Intergenic
922561340 1:226571929-226571951 AAGGGAAAAGGGGCCGGGTGTGG - Intronic
922751611 1:228072795-228072817 GATGTCCAAGGGGCCGGGGTGGG - Intergenic
922880344 1:228975738-228975760 CAGGGACAAGGAGGTGGGGAGGG - Intergenic
923545923 1:234923249-234923271 CAGGGAAAAGGTGGGGGGGTTGG - Intergenic
923697745 1:236270837-236270859 CAGGGATTAGGGACTGGGGTAGG + Intronic
924436708 1:244049001-244049023 CAGGGGCCAGGGGCCGGCGCCGG - Intronic
924740148 1:246790152-246790174 CAGGGACAGGAGGCCGAGGGAGG + Intergenic
924944833 1:248838933-248838955 CACGGGCAAGGGGCTAGGGTAGG + Intronic
1062873903 10:931013-931035 CAGGGTCGGGAGGCCGGGGTTGG - Intronic
1062941292 10:1423205-1423227 CTGGGACAAGGGCCCGGGCCAGG - Intronic
1064203113 10:13300568-13300590 CAGTGACAAGTGGCTGGGCTGGG + Intronic
1065898729 10:30186661-30186683 CAGGGACAATGAGCTGGGCTTGG + Intergenic
1067102490 10:43343095-43343117 CCAGGACAAGGGGTGGGGGTAGG - Intergenic
1067802624 10:49369578-49369600 CACGGACCTGGGGCCGGGGAGGG + Intronic
1068955170 10:62814963-62814985 AAGGCACAAGGCGCCGGGGATGG - Intronic
1069582195 10:69573576-69573598 TCCGGACAAAGGGCCGGGGTCGG + Intergenic
1070723401 10:78772200-78772222 CAGAGACAAGGGGTCAGGTTGGG - Intergenic
1071555005 10:86594696-86594718 CAGGGAAAAGGGGCAGAGGGAGG + Intergenic
1071821554 10:89285811-89285833 CAGGAACATGGGGAAGGGGTGGG - Intronic
1073053990 10:100687409-100687431 AAGGGAAAAGAGGCCGGGGCCGG - Intergenic
1073082412 10:100868429-100868451 CAGGGAGACGGGGCCTGGGTGGG + Intergenic
1073133750 10:101207746-101207768 CAGGGACAAGGAGCTGGGAGAGG - Intergenic
1073327202 10:102649898-102649920 CAGGGACCAGGGGGAGGAGTAGG + Intronic
1073642971 10:105271484-105271506 CACAGACAGGGGGCAGGGGTGGG + Intergenic
1074772040 10:116741213-116741235 CAGGAACAATGGGCTGGGGTGGG + Intronic
1074910044 10:117900091-117900113 CAGGGACTAAGGGGTGGGGTGGG + Intergenic
1075687693 10:124375793-124375815 CAGGGACAATGGGGTGGGGTTGG - Intergenic
1076522110 10:131087812-131087834 CAGAGAGAGGTGGCCGGGGTGGG + Intergenic
1076639058 10:131901452-131901474 CAGGGGCCAGGGGCCGAGCTGGG + Intronic
1076815199 10:132911171-132911193 AAGGGACAAGGGGCCGGCTCCGG - Intronic
1076855502 10:133113832-133113854 CAGGGACATGGGGAAGGGGCGGG - Intronic
1076991948 11:280039-280061 CGGGGACAAGGGTCGGAGGTGGG - Intronic
1077011567 11:381365-381387 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011596 11:381429-381451 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011625 11:381493-381515 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011654 11:381557-381579 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077024635 11:433732-433754 CAGGGCCATGGGGCTGGGGCGGG - Intronic
1077024651 11:433769-433791 CAGGGCCATGGGGCCGGGGCGGG - Intronic
1077533280 11:3107204-3107226 CCGGAACAAGGGGCCGAGGCAGG + Intronic
1077899514 11:6477692-6477714 TAGGGTCAAGGGGGTGGGGTTGG + Intronic
1078594511 11:12674726-12674748 CAGGGACCGGGAGCCGGGGAGGG + Exonic
1079175340 11:18135079-18135101 CAGGGACCAGGGGCTGGTATTGG + Intronic
1079266361 11:18936865-18936887 CAGGGACCAGGGGCTGGCATTGG - Intronic
1080351188 11:31387113-31387135 CTGGGACCAGGGCCCGGAGTTGG - Intronic
1080368666 11:31608967-31608989 CAGGGCCAAGGAGCTGTGGTAGG + Intronic
1081528322 11:43942256-43942278 CTGGGACCAGGGGGCGGGGGAGG + Exonic
1083344190 11:61978112-61978134 CATGGACAAGGGGTGGGGGAGGG - Intergenic
1083428394 11:62601386-62601408 CAGGGATACGGGGCCCGGGGCGG - Intronic
1083486101 11:62983909-62983931 TAGGGTCAAGGGGCTGGGCTGGG - Intronic
1083544480 11:63538342-63538364 CAGGGACAGGAGGCAGGGGCTGG + Intronic
1083550932 11:63589816-63589838 CAGGGACAGGTGGCCAGGGAGGG + Intronic
1083580108 11:63819140-63819162 CTGGTACACGGGGCCGGGGCAGG + Intronic
1083612915 11:64012824-64012846 AAGGAACAAGGGGCCGGGCATGG - Intronic
1083758204 11:64802485-64802507 TAGGGACAAAGAGCTGGGGTGGG + Intronic
1084116373 11:67045116-67045138 CAGGGCCACGGGGTTGGGGTGGG + Intronic
1084517172 11:69643292-69643314 CAGGACCACGGGGCCGGGGAAGG + Intronic
1084710839 11:70842909-70842931 CAGGCTCAGGGGGCCGGGCTGGG + Intronic
1087534461 11:99425501-99425523 GAGGGACAAGGTGGTGGGGTGGG + Intronic
1088813179 11:113405123-113405145 CAGGAAGAAGGGCCTGGGGTTGG - Intergenic
1088976244 11:114818669-114818691 CAGGGTTAAGGGGCCTGGGCAGG - Intergenic
1089184497 11:116605694-116605716 CAGGGCCCAGGGGCTGGGGAAGG - Intergenic
1089298560 11:117484047-117484069 CAGAGACACGGTGCCGGGGCAGG - Intronic
1089683172 11:120130739-120130761 CATGGACCAGGGGCCAGGCTGGG + Intronic
1089830549 11:121323951-121323973 AAGGGACATGGGGCTGGTGTTGG - Intergenic
1090183681 11:124722197-124722219 CAGGGAGAAGGTGCAAGGGTGGG - Intergenic
1090333049 11:125946041-125946063 CAGGGAGATGGGGCCATGGTGGG + Intergenic
1090699098 11:129278969-129278991 CGGGGAGATGGGGCCGGGGGCGG + Intronic
1090777810 11:129980516-129980538 CATGGACAAGGGGTTGGGGATGG - Intronic
1091280763 11:134380331-134380353 CAGGGACAGGGAGCCAGGGAGGG + Intronic
1091818901 12:3459700-3459722 CAGGGAGAAGGGCAGGGGGTTGG + Intronic
1091858254 12:3756184-3756206 CAGGGACATGAGTCCTGGGTTGG - Intronic
1093744207 12:22721490-22721512 GTGGGACTAGGGGCCGGGGTAGG - Intergenic
1094107971 12:26833305-26833327 CAGGGAGCAGCGGCCGGGGGCGG + Intergenic
1094499181 12:31007577-31007599 AGGGGCCAAGGGGTCGGGGTGGG - Intergenic
1095957766 12:47816700-47816722 CTGGGGCAAGGGGCAGGGGTGGG - Intronic
1096193470 12:49634446-49634468 GAGGGACAAGGTGCTGGAGTGGG + Exonic
1096284288 12:50284644-50284666 CAGGTACAAGGGGCCGGGCGCGG + Intergenic
1096389473 12:51217712-51217734 CCGGGCCAGGGGGCCGGGGCCGG + Intergenic
1096585591 12:52617745-52617767 CAGAGGCAAGGGACCAGGGTTGG - Intronic
1096668129 12:53180694-53180716 CCGGGGAAACGGGCCGGGGTTGG + Exonic
1096981122 12:55728714-55728736 CAGGGGAAAGGGGCTGGGGCGGG - Intronic
1097012793 12:55965400-55965422 CAGGAGCAAGGGGCGGGGGTGGG - Intronic
1097818148 12:64098314-64098336 CAGGGCCAGGGGGTAGGGGTTGG - Intronic
1098245645 12:68514352-68514374 CGGGGGCCAGGGGCCGGGGGAGG + Intergenic
1099722167 12:86377863-86377885 CAGGGACTTGGGGCCAGGGAAGG - Intronic
1100572722 12:95858366-95858388 CAGGGTCGTGGGGCGGGGGTGGG + Intergenic
1100884255 12:99052435-99052457 TAGAGACAAGGGGCCGGGCGCGG + Intronic
1100980586 12:100159284-100159306 AAGGGGCCAGGGGCCTGGGTAGG - Intergenic
1101642908 12:106601362-106601384 CAGGGACAGGAGACTGGGGTGGG + Intronic
1102182667 12:110924001-110924023 CAGGGACAAGGCCCTGGGATTGG + Intergenic
1102228408 12:111245714-111245736 CAGGTGCAAGGGGACAGGGTAGG + Intronic
1102263598 12:111461674-111461696 AAGGAACCAGGGGCCGAGGTAGG + Intronic
1102430223 12:112877363-112877385 CTGGGACTTGGGGCCTGGGTGGG - Intronic
1103010724 12:117456299-117456321 GAGGGAAAGGGGGCCGGGGCAGG + Exonic
1103565800 12:121814662-121814684 CAGGGAGAAGGGGCCCCGGTAGG - Exonic
1103577478 12:121889025-121889047 CAGGGACTCCGGGCCGGGTTAGG - Intronic
1103698662 12:122835975-122835997 GACGGAGATGGGGCCGGGGTTGG + Intronic
1103889424 12:124227710-124227732 CAGGAACCAGGGGCTTGGGTGGG - Intronic
1103900731 12:124302550-124302572 CTGGGGCAGGGGGCCGGGGCAGG - Intronic
1103992914 12:124811197-124811219 CTGGGGCAAGGGGTAGGGGTGGG + Intronic
1104069178 12:125329740-125329762 GAGTGTCAAGGGGCCGGGGCTGG - Intronic
1104140760 12:125984049-125984071 CTGGGGCCAGGGGCCAGGGTTGG + Intergenic
1104601224 12:130154786-130154808 CCGAGACAAGGGGCTGGGGAGGG + Intergenic
1104705859 12:130946846-130946868 CAGGGAGAAGAGGCCGAGATGGG + Intergenic
1106619315 13:31358230-31358252 CAGGAGCAAGTGGGCGGGGTCGG - Intergenic
1107513504 13:41107588-41107610 CAGGGACAGGTGGTGGGGGTTGG - Intergenic
1108415824 13:50197219-50197241 GAGGGTCAAGGGGCTAGGGTTGG + Intronic
1108591206 13:51914476-51914498 CAGGGACAGGGGACAGGGGCTGG + Intergenic
1111950524 13:94705667-94705689 CAAGGACAAGGAGCCGGGAGGGG + Intergenic
1112326691 13:98446438-98446460 CCTGGACAAGGGACGGGGGTTGG + Intronic
1112467763 13:99658629-99658651 CAGGAACAAGGAGGTGGGGTGGG + Intronic
1112475327 13:99726714-99726736 TAGGGATAAGGGGCGGGGGAGGG - Intronic
1112669089 13:101614045-101614067 CAGGGACAAGAGGGGTGGGTGGG + Intronic
1113565173 13:111315557-111315579 CAGGGAGGAGGGGCTGGGGGAGG - Intergenic
1113693932 13:112330828-112330850 CAGGAACACGGGCCCGGGGTCGG - Intergenic
1114674244 14:24430224-24430246 CAGGGCCCAGGGGCCGGGCCGGG - Intronic
1114811108 14:25900631-25900653 CAGGAACTAGGGGTAGGGGTAGG + Intergenic
1115408917 14:33050445-33050467 GAGGGACAAGGAGCCAGGGGAGG - Intronic
1117531531 14:56664889-56664911 CAGGGAGTGGGGGCTGGGGTGGG - Intronic
1117763846 14:59059714-59059736 CAGGGGCAGGGGGCAGGGGCAGG + Intergenic
1117763856 14:59059733-59059755 CAGGGGCAGGGGGCAGGGGCAGG + Intergenic
1118760959 14:68879903-68879925 CAGGGCCCTGGGGCAGGGGTTGG + Intronic
1119339053 14:73860135-73860157 CAGGCACAAGGGGCCAGGCGTGG - Intronic
1120704323 14:87731683-87731705 CAGAGACAAGGGGTGGAGGTGGG + Intergenic
1121301528 14:92875466-92875488 CAGGGAGATGTGGCAGGGGTGGG - Intergenic
1121305927 14:92906835-92906857 CAAGGACACGGGGACGGGGCAGG + Intergenic
1122246681 14:100408014-100408036 CAGGCACTGGGGGCGGGGGTTGG + Intronic
1122327296 14:100890443-100890465 CTGGGGCGGGGGGCCGGGGTGGG + Intergenic
1122437399 14:101709495-101709517 CAGGGAAACAGGGCAGGGGTGGG + Intergenic
1122518688 14:102327111-102327133 CAGGAACAAGGGGCAGGGGGAGG + Intronic
1122774773 14:104112279-104112301 CAGGGCGCAGGGGCAGGGGTGGG - Intronic
1122885142 14:104707539-104707561 CAGGGAGCAGGGGTGGGGGTGGG - Exonic
1122956315 14:105073183-105073205 CAGGGAGCAGGAGCCGGGATTGG - Intergenic
1123112151 14:105877775-105877797 CCAGGGCCAGGGGCCGGGGTGGG + Intergenic
1123708047 15:22964812-22964834 CAGGCAGACGGGGCTGGGGTTGG - Intronic
1124119347 15:26875712-26875734 CAGGGAGGAAGGGCTGGGGTTGG + Intronic
1125536319 15:40442401-40442423 GGGGGCCGAGGGGCCGGGGTGGG + Intronic
1125718823 15:41835452-41835474 CAGGGAGAAGAGGCAGAGGTTGG - Intronic
1126061955 15:44791539-44791561 AAGGGACAAGGGGACAAGGTGGG + Intergenic
1128331079 15:66756102-66756124 CAGGGAGAAGGGGGAGGTGTGGG - Intronic
1128562998 15:68680921-68680943 TAGGGAAAAGGGGCCGGGCGCGG + Intronic
1129287943 15:74541088-74541110 AAGGGACCGGGGGGCGGGGTGGG - Intergenic
1129516753 15:76161790-76161812 CAGAGACAAGAGGCCAGGGAGGG - Intronic
1129600600 15:76996150-76996172 AAGGGACAAGGGGCTGGGTGAGG - Intronic
1129672107 15:77613210-77613232 CTGGGACCAGAGGCTGGGGTGGG + Exonic
1130797794 15:87229015-87229037 GAGGGAAAAGGGGCTGGGGCAGG + Intergenic
1130969389 15:88720334-88720356 CAGGGAGAAAGAGCCGTGGTAGG - Intergenic
1131052304 15:89357022-89357044 CAGAGAAAAAGGGCCGGGCTTGG + Intergenic
1131171483 15:90181928-90181950 GAGGGAGAAGGTGCCGGAGTGGG + Intronic
1131411090 15:92208942-92208964 CAGGGTCCAGGGGCCGCTGTGGG + Intergenic
1132398721 15:101491620-101491642 CTGAGTCAAGGGGACGGGGTTGG + Intronic
1133020965 16:2966808-2966830 CGGGGACCAGGGGCCTGGGCGGG + Intronic
1133235137 16:4384178-4384200 CAGGAACAAAGGGCCCAGGTTGG + Intronic
1133235394 16:4385132-4385154 CAGGGACCAGGGGCAGACGTGGG + Intronic
1134527636 16:14956650-14956672 CAGGCACCAGGGGCCGGGCATGG + Intergenic
1136774591 16:32865043-32865065 CAGGGCAAAGGGGCAGGTGTAGG - Intergenic
1136896021 16:33996471-33996493 CAGGGCAAAGGGGCAGGTGTAGG + Intergenic
1137382925 16:48015195-48015217 CAGGAGCAAGGGGCCGGGGGAGG + Intergenic
1138455420 16:57117923-57117945 CACGGACAAGGGGCTAGGTTTGG - Intronic
1138552113 16:57753767-57753789 CAGGGACAAGTGGGCTGGGAGGG + Intronic
1138591243 16:58000696-58000718 CAGGGAGGCGGGGCCGGGGGAGG + Intronic
1139559094 16:67730337-67730359 CAGGGACCTGGGGGCAGGGTAGG + Intronic
1139562160 16:67749966-67749988 GAGGGATGAGGGGCAGGGGTAGG - Intronic
1140494030 16:75367454-75367476 TAGGGATAAGGGGGCAGGGTGGG + Intronic
1141206893 16:81939613-81939635 CAGGGACAAGGGAACGGGGGAGG - Intronic
1141694696 16:85613922-85613944 CCGAGACAAGGGGTCGGGGAGGG - Intronic
1141882159 16:86867317-86867339 GAGGGACAAGGGGCTGTGGCGGG - Intergenic
1142016777 16:87753043-87753065 CAGGGACAAGGGGCACAGGCAGG + Intronic
1142067107 16:88068969-88068991 CAGGGGCAGGGGGCTGGGCTGGG - Intronic
1142067120 16:88068999-88069021 CAGGGACAGGGGGCTGGGCTGGG - Intronic
1142141697 16:88475499-88475521 CAGGGGCAGGGGTCCGGGGGGGG + Intronic
1142194680 16:88733939-88733961 CAGGGACGAGGGGCTGGGCGTGG - Exonic
1142239762 16:88939934-88939956 CGGGGATAAGGGGCGGGGGCCGG - Exonic
1142284285 16:89165449-89165471 TAGGGAGAAGGGCACGGGGTAGG - Intergenic
1142304681 16:89278677-89278699 AAGGGAGAAGGGGGCGGGGCAGG + Intronic
1203077017 16_KI270728v1_random:1127179-1127201 CAGGGCAAAGGGGCAGGTGTGGG - Intergenic
1142603636 17:1069931-1069953 CAGGGGCACGGGGCGGGGGAGGG - Intronic
1143165610 17:4895899-4895921 CAGGGACTTGGGGCCTGGGTGGG + Intronic
1143325903 17:6098137-6098159 CAGAGACAGGGGGGCGGGGTGGG + Intronic
1143478877 17:7217529-7217551 CAGGGGCTAGGGGCCGTGGCGGG + Intronic
1143632291 17:8146202-8146224 CAGGGAAAAGGGGAAGGGGATGG + Intronic
1143887553 17:10076241-10076263 GAGGGACAGGGGGACGGGGAAGG + Intronic
1144017709 17:11212197-11212219 CAGGTACATGGGGCTGGGGCTGG - Intergenic
1144833053 17:18142430-18142452 CAGTCACAAGGGCCTGGGGTTGG - Intronic
1145779774 17:27554742-27554764 CAGGGACAGGGAGCGGGGGATGG - Intronic
1145900436 17:28487562-28487584 CAGAGACAAGGAGCAGGGCTGGG - Intronic
1146318407 17:31827137-31827159 CAGGGACAAGGGGAAAAGGTGGG + Intergenic
1146594539 17:34157331-34157353 CAGGGACAGGGAGCTGGGGCGGG - Intronic
1146789055 17:35741482-35741504 CGGGGGCAAGGGGCAGGGCTGGG - Exonic
1146925908 17:36745088-36745110 CAGGGAAACAGGGCTGGGGTGGG + Intergenic
1147889469 17:43707096-43707118 CAGGGACAAGTGCCTGGGCTGGG + Intergenic
1148127662 17:45245238-45245260 CAGGGACACTGGGCCAGGGATGG - Exonic
1148148073 17:45378615-45378637 CAGGTACAAAGGTCCTGGGTGGG - Intergenic
1148207916 17:45791213-45791235 GGGGGACAAGGGGCTGGGCTGGG + Intronic
1148242906 17:46012036-46012058 CAGGAACAAGGGCCCGGGCAGGG - Intronic
1148489829 17:48015749-48015771 AAGAGACAAGGGGTGGGGGTGGG - Intergenic
1148618503 17:49017019-49017041 TAGGGATAAGGAGGCGGGGTGGG + Intronic
1148645833 17:49219357-49219379 CAATGACAAGGGGGTGGGGTGGG + Intronic
1149242565 17:54667418-54667440 CAGGGACAAGGGACCAGGAGTGG + Intergenic
1149296301 17:55265093-55265115 CTGGCACTAGGGGCTGGGGTCGG + Exonic
1149562166 17:57616013-57616035 CTGGGACAAGAGGCCGGGCCCGG + Exonic
1150004680 17:61462490-61462512 GAGGGACAGGAGGACGGGGTGGG + Intronic
1150438224 17:65170522-65170544 CAGGGCTAAGGTGCAGGGGTTGG - Intronic
1151732937 17:75921713-75921735 CTGGGACACGGGGACGGGGCAGG + Intronic
1152029440 17:77832720-77832742 CATGGACTAGGGGCAGGGGATGG - Intergenic
1152504426 17:80738190-80738212 CAGGTACACGGGGCCGGGCTGGG - Intronic
1152608312 17:81303777-81303799 CAAGAACAAGGGGCTGGGTTGGG + Intergenic
1152779594 17:82220319-82220341 TGGGGCCAAGGGGCTGGGGTAGG + Intergenic
1154494331 18:14944632-14944654 CAGCGGCAGGGGGCCGGGGGGGG + Intergenic
1156881393 18:42084937-42084959 CAGGGAACAGGGGCCAGGGCTGG + Exonic
1158588979 18:58763813-58763835 CAGGGACTGGGGGCCCGGGAAGG + Intergenic
1160516022 18:79479766-79479788 CAGGGACAAAGGGCGGTGGACGG - Intronic
1160580896 18:79884215-79884237 CAGGGACATGGGGCATGGGGAGG - Intronic
1160591537 18:79947601-79947623 CGGTGAGAAGGGGCTGGGGTGGG - Intronic
1160722345 19:603150-603172 CAGGGAAGAGGGCCCGGGGCTGG + Intronic
1160722433 19:603386-603408 CAGGGAAGAGGGCCCGGGGCTGG + Intronic
1160724840 19:613546-613568 CAGAGCCAGGGGGCCGGGGCCGG + Intronic
1160843242 19:1155726-1155748 CCAGCACACGGGGCCGGGGTCGG - Intronic
1161285046 19:3464397-3464419 TAGGGCCAGGGAGCCGGGGTGGG - Intronic
1161313587 19:3607747-3607769 CCGGGCCCAGGGGACGGGGTGGG - Intergenic
1161331559 19:3690872-3690894 CAAGGAAAATGGGCCGGGGAGGG + Intronic
1161331757 19:3691959-3691981 CAGGGAAAAGAGCCTGGGGTGGG - Intronic
1161392446 19:4028475-4028497 CAGGGACCATGGGGCGGGGAGGG - Intronic
1161497675 19:4596469-4596491 CAGGGAGGAGGGGCCTGGGGGGG + Intergenic
1161533938 19:4807274-4807296 CTGGGACATGCGGCTGGGGTGGG + Intergenic
1161558344 19:4957015-4957037 TATGGTCAAGGGGCCAGGGTGGG + Intronic
1161735603 19:5990533-5990555 CAGGGCCAAGGGGCGGGGCGGGG + Intergenic
1162345404 19:10115443-10115465 CAGGGAGCAGGGGCTGGGGCAGG + Intronic
1162378348 19:10317827-10317849 CAGTGGCAGGGGGGCGGGGTGGG - Intronic
1162490214 19:10987082-10987104 CAGGGAGAAAGGGCCGAGGGTGG + Intronic
1162638300 19:11987547-11987569 CAGGGCTGAGGGGGCGGGGTAGG + Intergenic
1162765878 19:12919133-12919155 AAAGGACAAGCGGCCGGGCTCGG + Intronic
1162914011 19:13865019-13865041 CAGGGACACGGGGGCGCGGGCGG - Intronic
1163284571 19:16338437-16338459 CAGGGGCAAGGGGCAGAGGTAGG - Intergenic
1163404166 19:17112284-17112306 GTGGGACCAGGAGCCGGGGTGGG + Intronic
1163437168 19:17302781-17302803 CATGGACACGGGGGCGGGGGTGG - Intronic
1163660656 19:18575178-18575200 CAGGGCCACGGGGCCTGGGCAGG - Exonic
1163729477 19:18940977-18940999 CAGGGCCAAGGGGAGGGCGTGGG - Intronic
1164137421 19:22427525-22427547 CGGGAAGAAGGGGCGGGGGTTGG - Intronic
1164149028 19:22532730-22532752 CAGGGACAATGGGGTGGGGCGGG + Intergenic
1164704452 19:30309959-30309981 CAGGGACAAGTGGGAAGGGTAGG + Intronic
1164723874 19:30452416-30452438 CAGGGAGAAGGGGCAGACGTGGG - Intronic
1165230351 19:34382812-34382834 CAGGAACATGGGGCCAGGGCTGG + Intronic
1165394483 19:35556948-35556970 CAGGGACGGTGGCCCGGGGTGGG + Exonic
1165482583 19:36073539-36073561 CAGGGGCAAGGGGGTGGGGGGGG - Intronic
1165704425 19:37965711-37965733 CAGGGACTAGGGGTGGGGGCAGG - Intronic
1165774240 19:38395535-38395557 CAGGGGCAGGGGGCCTGGGGTGG + Exonic
1165858443 19:38894024-38894046 CTGGGACAGGCTGCCGGGGTTGG + Intronic
1166051744 19:40264719-40264741 GAGGGACAATGGGCTGGGGGCGG - Intronic
1166104225 19:40589554-40589576 GGGGGACCAGGGGCAGGGGTCGG + Intronic
1166137490 19:40786286-40786308 CAGGCAGAAGGGTCAGGGGTGGG + Intronic
1166835989 19:45668310-45668332 CAGGGAGAATGGGCTGGGATTGG - Intronic
1166878723 19:45914094-45914116 CAGGTCCAAGGGGGCGGGGCTGG + Exonic
1166945668 19:46394429-46394451 CAGAGCCAAGGGGCCGGGCATGG - Intergenic
1167148288 19:47695145-47695167 CAGGGAGAATGGGCTGGGGCAGG + Intronic
1167489971 19:49786889-49786911 CAGGGTCAAGGGGCCAGGGTGGG + Intronic
1167591544 19:50406937-50406959 CAGGGACCAGGGGTTGGGGGTGG - Intronic
1167742178 19:51330228-51330250 CAGGGTCCAGGGGATGGGGTGGG + Exonic
1168145387 19:54417082-54417104 CAGGGACACTGGCCCGGGGGAGG + Intronic
1168186845 19:54705584-54705606 CAGGGGCTGGGGGCTGGGGTAGG - Intergenic
1168322192 19:55517289-55517311 GAGGGACCTGGGGACGGGGTTGG - Exonic
926419539 2:12682920-12682942 CCAGGTCAAGGGGCAGGGGTTGG - Intergenic
926719141 2:15945914-15945936 CAGGGACCACGTGCCGGAGTTGG + Exonic
926811250 2:16757055-16757077 TGGGGTCAAGGGGCCCGGGTGGG + Intergenic
927054900 2:19358683-19358705 CTGAGGCAAGGGGCGGGGGTGGG - Intergenic
927638381 2:24831977-24831999 CAGGGACTGGGGGCAGGGGCCGG + Intronic
927878357 2:26673812-26673834 CAGGGTCAAGGGACAGGGGGTGG + Intergenic
927956610 2:27211816-27211838 CGGGGACAAGGGGGCGGGGAGGG - Intronic
927964743 2:27262143-27262165 CCGGGACAGCGGGCCGGGGGTGG - Intronic
928187442 2:29125204-29125226 CTGGCACCAGGGGCCGGGGTAGG - Intronic
929964665 2:46525182-46525204 CAGGGACAGGCGGCCGGGCGCGG + Intronic
932284579 2:70521323-70521345 CAGGGAAAAGGGGCAGTGCTGGG - Intronic
933787418 2:85854484-85854506 CAGGGAGAAGGGGCAGGGAGCGG + Intronic
934710700 2:96512178-96512200 CAGGGAAAAGGGGCCAGAGTAGG + Intergenic
935580267 2:104750320-104750342 CAGGGGCAAGGGGGCTGGGAGGG + Intergenic
935680817 2:105635664-105635686 CAGAGACGAGGGGCCTGGGCAGG - Intergenic
936105758 2:109623274-109623296 CACTGACAAGTGGCCGGGGGTGG - Intergenic
936388761 2:112054495-112054517 CAGGGAGATGGGGTCGGAGTGGG - Intergenic
936684198 2:114808739-114808761 CAGGTACAAGGGTCCCAGGTGGG - Intronic
937230941 2:120397780-120397802 CAGCGACAGGAGCCCGGGGTGGG + Intergenic
937914443 2:127092113-127092135 CAGGGACAGGGGGTAGAGGTGGG - Intronic
938905688 2:135833877-135833899 CAGAGGCCAGGGGCTGGGGTAGG - Intronic
944311129 2:198235093-198235115 CAGGGACAAGAGGGAGGGGGAGG + Intronic
944824952 2:203473352-203473374 CAGAAAAAAGGGGCAGGGGTGGG + Intronic
946407305 2:219498536-219498558 CAGCCACAAGGGGCTGGGGCTGG - Intergenic
946418528 2:219552371-219552393 CCGGGACTAGGGGCTGGGGGCGG + Intronic
947745288 2:232503991-232504013 CAGGAACAAGAGGCAGGGCTGGG - Intergenic
948281616 2:236751593-236751615 CAGGAACACAGGGCGGGGGTGGG - Intergenic
948458931 2:238119878-238119900 CAGGCCCCAGGGGCTGGGGTGGG - Intronic
948672820 2:239579361-239579383 GAGGGACGAGGGGCCAGGCTGGG + Intronic
948753393 2:240145028-240145050 CAGGGGGATGGGGGCGGGGTGGG - Intergenic
948883923 2:240873705-240873727 CAGGGACACGGTGCCTGGGGTGG + Intronic
1168773409 20:430258-430280 CAGAGGCAAAGGCCCGGGGTGGG + Intronic
1169506381 20:6215340-6215362 CAGGGAAAAGGGGTCGAGGCTGG + Intergenic
1170746307 20:19102100-19102122 CAGGGGCAAGGGATGGGGGTGGG + Intergenic
1171412625 20:24957119-24957141 CAGGGACAGGTGACAGGGGTAGG + Intronic
1171963921 20:31515281-31515303 CAGGGGCAAGGGCCAGGTGTGGG - Intronic
1172018593 20:31896266-31896288 TAGGGCCAGGGGGCCGGGCTAGG - Intronic
1172183783 20:33019145-33019167 CTGAGACAAGGGACTGGGGTGGG + Intronic
1172303260 20:33864311-33864333 CAAGGACAAGCGGCAGGTGTAGG - Intergenic
1172306216 20:33882578-33882600 CAGAGACAAGGAGGTGGGGTGGG - Intergenic
1173186608 20:40845057-40845079 AAGGGAGAAGGGGCTGGGCTGGG - Intergenic
1173279943 20:41618693-41618715 CAGGGCCACGGGGGCGGGGCGGG + Intergenic
1173282631 20:41643110-41643132 CATGGTCAAGGGGCCGGGCATGG - Intergenic
1173781133 20:45758399-45758421 CAGGGACCAGGTACCAGGGTGGG + Intronic
1173916562 20:46712417-46712439 CAGGGTCAGGGGGCAGGGGGAGG - Intronic
1174051195 20:47768741-47768763 CAGGGACAGAGGGCCAGGGAAGG - Intronic
1174162327 20:48560468-48560490 CAGGGTCTAGGGGCTGGGGCAGG - Intergenic
1174308738 20:49633914-49633936 CAGGGACAAAGGCCCGGTGGGGG + Exonic
1174543094 20:51304927-51304949 GAGGGACAGGAGGCCTGGGTGGG + Intergenic
1174835571 20:53853425-53853447 CAGGGACATGGGGATAGGGTGGG + Intergenic
1175089912 20:56493964-56493986 CAGGGAGGAGGGGCAGGGCTGGG - Intronic
1175599566 20:60262141-60262163 CAGGGACATGGGGCAGGACTAGG + Intergenic
1175902555 20:62365886-62365908 CAGGGCCAAGGGGGTGGGGCAGG + Intronic
1175948480 20:62569841-62569863 GAGGGACAGGGTGCTGGGGTGGG - Intronic
1176028063 20:62996258-62996280 CAGGGACACAGTGCCGAGGTCGG + Intergenic
1176099666 20:63359183-63359205 CAGGGACAACCGGCCGGGGCAGG - Intronic
1176305553 21:5121302-5121324 CAGGGACAAAGGGGCGTGGTTGG + Intronic
1178204206 21:30444244-30444266 CAGGGAGAATGGGCTGGGGTGGG - Intergenic
1179007748 21:37529927-37529949 CAAGGGCAAGGGCCCAGGGTTGG + Intergenic
1179488244 21:41724523-41724545 CAGGGACAAGGGCACGGATTTGG - Intergenic
1179488251 21:41724548-41724570 CAGGGACAAGGGCACGGAGTTGG - Intergenic
1179634093 21:42696390-42696412 TAGGGACAAGGGGCAGGGGAAGG + Intronic
1179798238 21:43798188-43798210 CAGAGACAAGGGGACCAGGTAGG - Intronic
1179801266 21:43812486-43812508 CAGTGACAATGGGCCGGGCCAGG + Intergenic
1179851503 21:44140729-44140751 CAGGGACAAAGGGGCGTGGTTGG - Intronic
1180057149 21:45364861-45364883 CGGGGACAAGGGGCCGGACGAGG + Intergenic
1180067294 21:45418805-45418827 CAGGCACAGGAGGTCGGGGTGGG - Intronic
1180209604 21:46286622-46286644 CAGAGAAAAGGGGGCGGGTTGGG - Exonic
1181060051 22:20278122-20278144 CAGGGCAAGGGGGCCGGGGCTGG - Intronic
1181919072 22:26305836-26305858 CCTGGGCAAGGGGCAGGGGTGGG + Intronic
1181955647 22:26586196-26586218 TAGGGACATGGAGACGGGGTGGG - Intronic
1182751232 22:32643799-32643821 AAGAGACAAGGGGCCGGGCGCGG + Intronic
1182927568 22:34139939-34139961 CAAGGAGAAGGGGCCGGGCATGG + Intergenic
1183052011 22:35270502-35270524 CATGGACCTGGGGCAGGGGTAGG - Intronic
1183413839 22:37671563-37671585 CAGGGACAGGGGGCAGAGGCGGG - Intergenic
1183560649 22:38570205-38570227 GAGGACCAAGGGGCCGGGGCGGG + Exonic
1183670605 22:39270353-39270375 TAAGGGGAAGGGGCCGGGGTGGG - Intergenic
1183722154 22:39568853-39568875 CGGGGGCAACGGGCAGGGGTTGG - Intergenic
1183859657 22:40660594-40660616 TAGGGACAGGGAGCTGGGGTGGG + Intergenic
1184039205 22:41933349-41933371 CAGGGAGAGGGGGTGGGGGTGGG + Intergenic
1184179346 22:42809539-42809561 CAGGGGCCAGGGGCAGGGGAGGG + Intronic
1184345176 22:43908777-43908799 CCCAGAGAAGGGGCCGGGGTGGG + Intergenic
1184557489 22:45241028-45241050 CGGGGCCAGGGAGCCGGGGTGGG - Intergenic
1184935694 22:47718733-47718755 GAGGGACACGGGGACAGGGTGGG - Intergenic
1185070864 22:48654915-48654937 CTGGGAGGAGGGGCCGTGGTGGG + Intronic
1185205058 22:49533172-49533194 TGTGGAGAAGGGGCCGGGGTGGG - Intronic
1185343796 22:50302745-50302767 CAGGGGCAAGGGGCAGGTGGTGG - Intronic
949258541 3:2079488-2079510 CAGTGGAAAGGGGACGGGGTGGG - Intergenic
950002089 3:9664765-9664787 CAGGAACAAGGGGGAGGAGTGGG + Intronic
950261380 3:11545139-11545161 CAGAGAGAGGGTGCCGGGGTGGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950533895 3:13568620-13568642 CAGGGCCAAGGGGCTGAGGCCGG - Intronic
951267351 3:20584533-20584555 GTGGGACAAGGGCCAGGGGTAGG + Intergenic
952312892 3:32206305-32206327 TAGAGACAAGGGGCTGGGGGTGG + Intergenic
953897392 3:46812581-46812603 GAGGGACGAGGGGGCGGGGCGGG + Intergenic
953901538 3:46846555-46846577 CAGGGACACAGGCCCCGGGTGGG - Intergenic
954417164 3:50399015-50399037 CAGGGACCTGGGGCCAGGATGGG + Intronic
954454114 3:50587810-50587832 CAGGAAAAAGGGGCTGGGGCAGG + Intergenic
954693719 3:52409730-52409752 CAGGGTGAAGAGGCCTGGGTGGG + Exonic
955409951 3:58649005-58649027 CAGAGACAGGGGGCAGGGGCAGG + Intronic
955677361 3:61462876-61462898 TAGGGACAAGAGGCCGGGTGCGG + Intergenic
957017949 3:75091908-75091930 CAGGGACCAGGGGGAGTGGTGGG - Intergenic
957085803 3:75675460-75675482 CAGGGACAGTGGACTGGGGTGGG - Intergenic
958072290 3:88629822-88629844 CAGGGAGAATGGGCCGGGCGCGG + Intergenic
959849524 3:111071288-111071310 CTGGGACGAGGGGGTGGGGTGGG - Intronic
960692202 3:120358489-120358511 CAGGAACAAGAGGCCGGGTGTGG - Intergenic
961528814 3:127526895-127526917 CAGGGACAATGTGCCAGGGGAGG + Intergenic
961734831 3:128994791-128994813 CTGGGACAGAGGGCTGGGGTAGG + Intronic
962156827 3:132956830-132956852 CAGGCACACGGGGCAGGGGCGGG - Intergenic
963152354 3:142058683-142058705 CAGGGCAATGGGGCAGGGGTAGG + Intronic
964066268 3:152583646-152583668 CAGTCACAAGGGGCAGGGGTGGG + Intergenic
966800230 3:183756640-183756662 CATGGACAAGCAGCCGGGGCAGG + Exonic
967080015 3:186041226-186041248 CATGCAGAAGGGGCGGGGGTGGG + Intergenic
968032407 3:195511641-195511663 GGGGGACAAGGGGCTGGGGAAGG - Intergenic
968550680 4:1222189-1222211 CAGGGACAAGGGCGAGGGGCGGG + Intronic
968739347 4:2319512-2319534 CAGTGATCAGGGGCCGTGGTAGG + Intronic
968879741 4:3292914-3292936 CGGGGCCAAGGGGGTGGGGTTGG - Intergenic
969101077 4:4768680-4768702 CGGTAACAAGGGGCCGGGGTGGG - Intergenic
969291453 4:6242732-6242754 CGGGGACAGGGTGCTGGGGTTGG - Intergenic
969405195 4:6987074-6987096 CGGGCACAAGGGGCGGGGCTGGG - Intronic
969419360 4:7082807-7082829 CAGGAACAAGGGGCCGGGCATGG - Intergenic
969448276 4:7257745-7257767 GAAGGACAAGGGGCTGGGGGAGG - Intronic
969540372 4:7784739-7784761 CAGGTTCTAGTGGCCGGGGTCGG - Intronic
969627009 4:8310794-8310816 CAGGGTCAAGAGGTGGGGGTGGG + Intergenic
969636061 4:8370172-8370194 CAGGCACAAGGCCCTGGGGTGGG + Intronic
969924447 4:10573376-10573398 CTGGGACCAGGGGCAGGTGTAGG - Intronic
971354614 4:25884091-25884113 CAGGGACAAGGGGTGAGGCTGGG - Intronic
973700099 4:53528766-53528788 CAGGGAGATGGTGCCAGGGTAGG - Intronic
974900288 4:67988263-67988285 CATGGACCAGGGGCCGGGCGCGG + Intergenic
975242908 4:72082814-72082836 CAGGGAGTGGGGGCTGGGGTGGG - Intronic
978477997 4:109153966-109153988 CAGGGACAAGGGTCATGTGTTGG - Intronic
985444213 4:190012065-190012087 CAGGGACAGTGGACTGGGGTGGG + Intergenic
985489815 5:172570-172592 CCGGGAACGGGGGCCGGGGTGGG + Intronic
985726355 5:1517882-1517904 AGGGGACAAGGGGACGAGGTCGG + Intronic
986805439 5:11304593-11304615 CAGGGACAAGGAACAGTGGTGGG + Intronic
989146714 5:38257749-38257771 CTGGGGCAGGGGGCCGGGGCGGG - Intergenic
990080666 5:51909899-51909921 CTGGAAGAAGGGGCCAGGGTTGG + Intergenic
990452617 5:55950244-55950266 CAGGGTCAAGAGGCCGGGTGCGG + Intronic
990614602 5:57494740-57494762 CAGAGATAAGGGGCAGGGTTGGG - Intergenic
997738006 5:136228615-136228637 CAGAGGCAGGGGGCTGGGGTGGG + Intronic
998168881 5:139860408-139860430 CAGGGACATGGGGCCAGTCTGGG - Intronic
999044629 5:148453675-148453697 CAGGGCCAAGTGGGCGGGGGTGG + Intronic
999132242 5:149293072-149293094 CAGGGACAAGAGGGCATGGTGGG - Intronic
999480183 5:151940962-151940984 CAGGGCAAAGGGGCGGGGGTGGG + Intergenic
999498802 5:152126058-152126080 AAGGCACCAGGGGCGGGGGTGGG - Intergenic
1000018062 5:157295922-157295944 CAGGGGAAATGGGCCTGGGTAGG + Intronic
1000021307 5:157321694-157321716 CAGGGAGAAGGGTCGGGGGTGGG - Intronic
1000120881 5:158196875-158196897 CAGGAACAAGGGGCTGAGGGAGG - Intergenic
1001402807 5:171456021-171456043 CAGGTACAAGGGGCATGGGCAGG - Intronic
1002098079 5:176843832-176843854 CAGGGGCCAGGGGCCAGGGCTGG - Intronic
1002900099 6:1404156-1404178 CATGGCCAAGGGGCTTGGGTTGG - Intergenic
1003297313 6:4843131-4843153 AAGGGACTAGGGGTTGGGGTGGG - Intronic
1004607300 6:17206467-17206489 GAGGGGCAAGGGGGCGGGGAGGG + Intergenic
1004928700 6:20440914-20440936 CAGTGAAAAGGGTCAGGGGTAGG + Intronic
1006173687 6:32109467-32109489 CAGGGAGTGGGGGCTGGGGTGGG - Intronic
1006579639 6:35069307-35069329 CAGGGACAAGGGACAATGGTGGG - Intronic
1007414671 6:41684558-41684580 CAGGGAACAGGGGCCGGCCTGGG - Exonic
1007921635 6:45615618-45615640 CAGGGAAAAGGGACAGGGATAGG - Intronic
1008602827 6:53112468-53112490 CAGAGCAAAGGGGCAGGGGTAGG - Intergenic
1011274153 6:85612901-85612923 CAGGGAAAAGGGGTCGAGGCCGG - Exonic
1011625931 6:89283784-89283806 CAGGGAGAAGTGTACGGGGTGGG + Intronic
1011731505 6:90269152-90269174 CAGAGACAAGTGGCAGGGTTAGG + Intronic
1013332201 6:109114668-109114690 CAGAGGCAAGGGGCAGGGGATGG + Intronic
1017995923 6:159531560-159531582 CAGGGCAAAGGTGCAGGGGTAGG + Intergenic
1018056484 6:160056605-160056627 CAGAAAGAAGGGGCAGGGGTCGG - Intronic
1018205833 6:161436289-161436311 CAGAGAGCAGGGGCCGGGATGGG + Intronic
1018650554 6:165988454-165988476 TAGTGACAAGGGGCGGGGGTCGG - Intergenic
1019190677 6:170249042-170249064 CAAGGCCTGGGGGCCGGGGTGGG - Intergenic
1019379194 7:712394-712416 CAGGTACGCGGGGCCGGGCTGGG - Intronic
1019402970 7:866777-866799 CAGGGAGAAGGGGGCGGGGAGGG - Intronic
1019440449 7:1043592-1043614 CAGGGACCTGGTGCCGGGCTGGG + Intronic
1019483304 7:1276131-1276153 GAGGGAGAGGGGGCCGGGGCCGG - Intergenic
1019938216 7:4269979-4270001 GTGGGAGGAGGGGCCGGGGTGGG + Intergenic
1019965384 7:4494534-4494556 CAGGCACAACGGGCCGGGCACGG + Intergenic
1021163111 7:17299397-17299419 CAGGGATTTGGGGGCGGGGTGGG - Intronic
1021311417 7:19102514-19102536 CATGGGCAGGGGGGCGGGGTAGG - Intronic
1021942272 7:25689530-25689552 CAGGGCCATGGGGCCTGGGCAGG + Intergenic
1022321587 7:29293230-29293252 CAGGGCCAAGGGGACAAGGTGGG - Intronic
1022527605 7:31048618-31048640 CAGGGACAAAGGGCCTTAGTGGG + Intergenic
1022530895 7:31066245-31066267 CAGGAACAATGGCCCTGGGTTGG - Intronic
1022728753 7:33003748-33003770 CAGGGACAAGAGGCCTGAGAGGG - Intronic
1023221067 7:37920732-37920754 CCGGGACCAGGGCCCGGGGAAGG - Exonic
1023937147 7:44748489-44748511 CGGGGCCAAGGTGCCGGGGCGGG - Intergenic
1024780814 7:52846257-52846279 CATGGACAGGGGGTCGAGGTTGG + Intergenic
1025044896 7:55684241-55684263 CAGGGACAAGAGGCCTGAGAGGG + Intergenic
1025198517 7:56948897-56948919 CAGGGCCCAGGGGTCCGGGTCGG + Intergenic
1025673434 7:63628036-63628058 CAGGGCCCAGGGGTCCGGGTCGG - Intergenic
1025776787 7:64567974-64567996 CAGGGTCCAGGGGATGGGGTGGG - Intergenic
1026977745 7:74508737-74508759 AAGGGACAAGGGGACGAGGGCGG - Intronic
1027228615 7:76260092-76260114 GGGGGAGAAGGGGCGGGGGTGGG - Intronic
1028437970 7:90827068-90827090 CAGGGACAGGCAGCAGGGGTGGG - Intronic
1028473094 7:91225527-91225549 CATGGACAAGGGCCAGGGGGTGG - Intergenic
1029270409 7:99374189-99374211 GAGGGCCAAGGGGGCGGGGCCGG + Intronic
1029402595 7:100355253-100355275 GAGGGGCAAGGGGCTGGGGCAGG + Intronic
1029477165 7:100791985-100792007 GAGGGACAAGGGGCGGAGCTGGG + Exonic
1029536973 7:101162877-101162899 CAGGGCCAAGGGGCAGGGCCGGG + Exonic
1029642454 7:101829671-101829693 GATGGAAATGGGGCCGGGGTGGG + Intronic
1029715770 7:102324612-102324634 GAGGGGCAAGGGGCCAGGGCAGG + Intergenic
1029896646 7:103990213-103990235 GAGGGACAGGGGGCCTGGGTGGG - Intergenic
1030077374 7:105748276-105748298 AAGGGACAAAGGGCAGCGGTGGG + Intronic
1030295491 7:107921852-107921874 CATGGACAAGGGGATGGGGGTGG - Intronic
1032241445 7:130162361-130162383 CAGGGACCAGTGGCGGGGGCCGG - Intergenic
1032334035 7:131008030-131008052 CAGGGACTAGGGGTGGGGGCAGG - Intergenic
1032458544 7:132092593-132092615 CAGGGACAGAGTGGCGGGGTAGG - Intergenic
1032686128 7:134235512-134235534 CAGGGAAAAGGGGCTAGGGAGGG - Intronic
1033133742 7:138767816-138767838 CAGGGATGAGGGGCAGGGCTGGG - Intronic
1033257734 7:139816778-139816800 CAGGGAGCAGGGGCAGGGATGGG - Intronic
1033586521 7:142778696-142778718 CAGGGACTGGGGGCCGTGGTAGG + Intergenic
1034523063 7:151635671-151635693 CGGGGATCAGGGGCTGGGGTAGG + Intronic
1035038050 7:155908167-155908189 TAGGGAGAAGGGGGAGGGGTGGG + Intergenic
1035132638 7:156669731-156669753 CAGGGAGAAGGGGCCATGGCTGG + Intronic
1036430652 8:8687081-8687103 CAGGGACATGGGGCCAAAGTGGG - Intergenic
1036621037 8:10424660-10424682 CGGGGAGAAGGGCCCGGGGTGGG + Intronic
1037564487 8:20105946-20105968 GAGGGAGAAGGGGGTGGGGTGGG + Intergenic
1038184901 8:25264246-25264268 CAGCTACCAGGGGTCGGGGTTGG + Intronic
1039419388 8:37423056-37423078 CAGGGACTGGGGGCAGGGGAAGG + Intergenic
1039436688 8:37564325-37564347 CAGGGAGGAGGGCCTGGGGTTGG - Intergenic
1039964101 8:42271440-42271462 CAGGGACGCGGGGCAGGGGGCGG - Exonic
1040517168 8:48144562-48144584 CAAGGCCACAGGGCCGGGGTGGG + Intergenic
1040555545 8:48474731-48474753 CAGGGACTGGGGGTAGGGGTGGG + Intergenic
1040914907 8:52558995-52559017 CAGGAGCAAGGGGCAGGGGAGGG + Intronic
1041107502 8:54457787-54457809 GAGGGGCAAGGGGCGGGCGTGGG + Intergenic
1041248778 8:55914515-55914537 CTGGGACTAGGGGCCTGGGTAGG + Intronic
1043467669 8:80528488-80528510 CAGGGACAAGGTGCGGGGGAAGG - Intergenic
1043514682 8:80985174-80985196 CGGGGACCAGGGGCTGGGGATGG - Exonic
1044770445 8:95625562-95625584 CAGGGACAATGGGCCAGGCGTGG + Intergenic
1047262418 8:123274555-123274577 CCCGGACTAGGGGCCGGGGTCGG - Intronic
1047301655 8:123618698-123618720 CAAGGACCAGGGGCAGGGGATGG - Intergenic
1048115226 8:131514220-131514242 CAGGAGCAAGGGGTCGGGGTGGG - Intergenic
1048471005 8:134704122-134704144 CAGGGAAAAGGGGCCCTGGGGGG - Intronic
1049103487 8:140596803-140596825 GAGAGGCAAGTGGCCGGGGTGGG + Intronic
1049289373 8:141793603-141793625 CAGGGGCAAGTGGCCTGGGAGGG - Intergenic
1049404701 8:142447225-142447247 CAGGGAGACGGGGCTGAGGTGGG + Intergenic
1049441338 8:142611145-142611167 GTGGGGCAAGGGGCAGGGGTTGG + Exonic
1049674393 8:143883287-143883309 CAGGGGCCAGGGGCCAGGGGCGG + Intergenic
1049696199 8:143985436-143985458 CAGTGCCCAGGGGCCCGGGTAGG + Exonic
1049708077 8:144051851-144051873 GAGAGACCAGGGGCGGGGGTGGG + Intronic
1050556956 9:6797842-6797864 CAGGGAATAGGGGCCAGGCTGGG + Intronic
1051898438 9:22012566-22012588 CAGGGCCATGGGGCCTGGGCAGG - Intronic
1054735288 9:68744558-68744580 CAGGGAGAGGGGGCTGTGGTTGG + Intronic
1054815174 9:69467777-69467799 CAGGGACAGGGGGCTGGTGTAGG - Intronic
1056139420 9:83660670-83660692 CAGAGAAAGGGGGACGGGGTGGG - Exonic
1057995571 9:99819835-99819857 CGGCGACGAGGGGCCGGGCTCGG - Intergenic
1059465928 9:114468882-114468904 CTGTGACAAGGGACCAGGGTGGG - Intronic
1060093328 9:120764392-120764414 CAGGGGCCAGGGCTCGGGGTGGG - Exonic
1060189931 9:121585981-121586003 CAGCGACAGGGAGCCAGGGTGGG - Intronic
1060785957 9:126451710-126451732 GAGGCACAAGGGTCCTGGGTGGG + Intronic
1060836050 9:126755812-126755834 CAGTGATATGGGGCCGGGGGCGG + Intergenic
1060938629 9:127530473-127530495 CTCGGACACGGGGCCGGGGGCGG - Intronic
1061043907 9:128154171-128154193 CGGGGAGAAGGGGCTGGGGAGGG - Intergenic
1061075688 9:128340340-128340362 CAGGGGGCAAGGGCCGGGGTCGG + Intergenic
1061084317 9:128390332-128390354 CAGGGTCAAGGGCTAGGGGTGGG - Exonic
1061092456 9:128434248-128434270 CAGGGACAAGGGGGCAGGGTGGG + Intronic
1061257496 9:129460955-129460977 CAGGGACAAGGGTCCGCGGAGGG + Intergenic
1061277733 9:129579080-129579102 CAGGGAAAAGGGGTCTGGATGGG + Intergenic
1061288413 9:129637341-129637363 GAAGGAAAAGGGGCAGGGGTGGG + Exonic
1061482423 9:130903556-130903578 CAGGGAAACGGGGTGGGGGTTGG + Exonic
1061654645 9:132079612-132079634 CCGGCTGAAGGGGCCGGGGTCGG - Intronic
1061988109 9:134142162-134142184 CAGGGGCATGGGGCGGGGGTGGG + Intronic
1062040421 9:134401895-134401917 CTGGGGCAAGGGGAGGGGGTGGG + Intronic
1062246079 9:135566815-135566837 CAGGGACGAGGGCCTGGGGTCGG + Exonic
1062443307 9:136583174-136583196 CAGGCACAATGGGCATGGGTAGG - Intergenic
1062619971 9:137416307-137416329 CAGGGACAAAGGGGCGGACTTGG + Intronic
1185575070 X:1164882-1164904 CAGGAGCAAGGGGCCGGGTCCGG - Intergenic
1185610747 X:1392563-1392585 AAGGGTCAAGGGTCGGGGGTCGG - Exonic
1185891753 X:3828266-3828288 CAGGGACAAGGGGCCGGGGTAGG - Intronic
1185896861 X:3866682-3866704 CAGGGACAAGGGGCCGGGGTAGG - Intergenic
1185901979 X:3905108-3905130 CAGGGACAAGGGGCCGGGGTAGG - Intergenic
1186272900 X:7908818-7908840 CAGGGTCAAGGGGCTTGGGTGGG + Intronic
1186468672 X:9804357-9804379 CAGAGACAAGGAGCCTGGGGAGG - Intronic
1187018699 X:15357383-15357405 CAGGGAGTAGGGGCAGGGGCTGG - Intronic
1187245303 X:17548428-17548450 CAGGGAACAGAGGCTGGGGTGGG + Intronic
1187944454 X:24412657-24412679 CAGGAACAAGGGGCTAGGGGAGG - Intergenic
1189038886 X:37520938-37520960 CAAGGAAATGGGGCCGGGGAAGG + Intronic
1189197833 X:39166762-39166784 CAGGGATCAGGGGGCAGGGTGGG - Intergenic
1189422790 X:40871551-40871573 AAGGGAAAAGGAGCAGGGGTGGG - Intergenic
1189726170 X:43969821-43969843 AAGGGAAAAGGGGGCGGGCTGGG + Intronic
1191633505 X:63351128-63351150 CGGGGACTTGGGGTCGGGGTTGG - Exonic
1192147491 X:68691417-68691439 CAGGGGCAGGGAGCAGGGGTTGG + Intronic
1195704037 X:107725795-107725817 CAGGGACATGCGGCGGGGGAGGG + Intronic
1199167151 X:144690492-144690514 CAGGGATCAGGGGCTGGGGGTGG - Intergenic
1199661286 X:150053383-150053405 CAGAGAAAAGGGGCTTGGGTGGG - Intergenic
1200069032 X:153518677-153518699 CAGGGGCATGGCGCCGGGGCAGG + Intronic
1200104187 X:153703303-153703325 CAGGGGCCAGGGGCCAGGGCAGG - Intronic
1200105353 X:153709012-153709034 CAGGGCAAAGGGGCAGGTGTGGG + Intronic
1200147613 X:153934779-153934801 CAGGGCCACCGGGCCGGGCTCGG + Intronic
1201448966 Y:14089243-14089265 CAGGGTCAAGGGGCTTGGGTGGG - Intergenic
1201555584 Y:15262379-15262401 CAGGGTCCAGGGGCCGTTGTGGG + Intergenic
1202253070 Y:22893028-22893050 CAGGGAAAAGGTGTAGGGGTGGG + Intergenic
1202406060 Y:24526777-24526799 CAGGGAAAAGGTGTAGGGGTGGG + Intergenic
1202464720 Y:25143304-25143326 CAGGGAAAAGGTGTAGGGGTGGG - Intergenic