ID: 1185891847

View in Genome Browser
Species Human (GRCh38)
Location X:3828812-3828834
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 2, 1: 1, 2: 2, 3: 22, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185891847_1185891849 2 Left 1185891847 X:3828812-3828834 CCTCTGATCTTCTTCCACACTGA 0: 2
1: 1
2: 2
3: 22
4: 234
Right 1185891849 X:3828837-3828859 TCTGAATCATCATCAGAATCTGG 0: 3
1: 0
2: 0
3: 21
4: 210
1185891847_1185891850 16 Left 1185891847 X:3828812-3828834 CCTCTGATCTTCTTCCACACTGA 0: 2
1: 1
2: 2
3: 22
4: 234
Right 1185891850 X:3828851-3828873 AGAATCTGGCAGATGACCGTCGG 0: 3
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185891847 Original CRISPR TCAGTGTGGAAGAAGATCAG AGG (reversed) Intronic
901001788 1:6152509-6152531 GGAGTGAGGAAGAAGATCAAAGG - Exonic
901345620 1:8538758-8538780 CAAGTGTAGAAGAAAATCAGTGG + Intronic
901668886 1:10842584-10842606 TCAGTGGGGAGGATGAGCAGTGG - Intergenic
902136274 1:14308786-14308808 TCAGTATGGGTGAAGGTCAGTGG + Intergenic
902369770 1:15998590-15998612 CCAGTGGGGAAGATGCTCAGTGG + Intergenic
903044950 1:20557551-20557573 GCAGGGTGGAAGTAGAGCAGTGG - Intergenic
905188476 1:36214412-36214434 TCAGTGGGGATGAAGAAAAGTGG - Intergenic
905990147 1:42330334-42330356 TAAGTCCGGAAGAAAATCAGTGG + Intronic
907053100 1:51342964-51342986 TCAGTGTGCAGGGAGAGCAGAGG - Intronic
907307823 1:53523336-53523358 TCAGTGGGAAAGAAGATGGGAGG - Intronic
908569890 1:65398403-65398425 TCAGTGTGCAATAAGAAAAGGGG - Intronic
908734562 1:67262587-67262609 TCAGGGTGGAAGATAATCAGTGG - Intergenic
910134777 1:83955086-83955108 TAAGTGTGGTAGAAGCTCAACGG - Intronic
910356421 1:86362153-86362175 TGAGAGTGGAAGAAGAAGAGAGG + Intronic
910414987 1:86988056-86988078 GCAGTGGGGATGAAGATCTGTGG + Intronic
911431814 1:97799114-97799136 TCAGTGTGGATGAAGTTTGGTGG - Intronic
913334925 1:117700649-117700671 CCAGTGTGGAGGAAGAGCAAGGG + Intergenic
916092648 1:161319869-161319891 TCAGTGTGGCAGAATTACAGTGG + Intronic
917285956 1:173421695-173421717 TCAGTGGGGAAAAAAATAAGGGG - Intergenic
917615431 1:176738756-176738778 CCAGTGTGGAAGATGAACACTGG + Intronic
918053028 1:180991123-180991145 TCAGTATGGAGGAAGGTCATGGG - Intronic
918441557 1:184572578-184572600 TCATTGTTGAAGATGATCATTGG + Intronic
918546260 1:185687960-185687982 TCAGTGTGTAAGAAAAAGAGAGG + Intergenic
921141349 1:212310012-212310034 TCTCTGAGGAACAAGATCAGAGG - Intronic
921304950 1:213786802-213786824 TCACTGAGGAAGAAGATTTGGGG - Intergenic
923712321 1:236397107-236397129 ACAGTGTGTAAAAAGCTCAGTGG + Intronic
923876112 1:238049495-238049517 TCAGTGTGGGAGAGGGTGAGAGG + Intergenic
924926095 1:248682418-248682440 GCAGTGTGGAAGATGTCCAGTGG - Intergenic
1064477403 10:15705984-15706006 TGAGTGTGGATGAAGAGAAGAGG - Intronic
1066524767 10:36264850-36264872 TCACTGTGGGAGAATATCAGGGG - Intergenic
1069684005 10:70305472-70305494 TTAATGATGAAGAAGATCAGAGG - Intronic
1072166087 10:92814472-92814494 TGGGAGTGGAAGGAGATCAGAGG - Intergenic
1075653442 10:124145389-124145411 TCAGTGGGGAAGAAGTTCAAGGG - Intergenic
1078053710 11:7989386-7989408 CCAGTCTGGAAGAGGATCTGAGG - Intronic
1081736063 11:45405143-45405165 TCAGTGAGGAAGAAGAGAATGGG + Intergenic
1082255986 11:50033639-50033661 TCAGTGGGGAAGGAGGTTAGAGG - Intergenic
1085736063 11:79040342-79040364 TCAGTGAGGAAGAAGGAGAGGGG - Intronic
1086421767 11:86644457-86644479 TCAGGGTGGAAAGAGCTCAGGGG - Intronic
1087176824 11:95104123-95104145 TAAGTCTGGGAGCAGATCAGAGG - Intronic
1088173665 11:107024978-107025000 TCAGTGTGGAATAAAATATGAGG - Intergenic
1088427494 11:109720462-109720484 ACAGAGTGGAAGAAGAGGAGAGG + Intergenic
1091060685 11:132458801-132458823 TGAGTGTGGAAGCAGATGTGGGG - Intronic
1092776842 12:11951133-11951155 ACAGTGGAGAAGAAAATCAGTGG + Intergenic
1093551377 12:20415803-20415825 TCAGTGTGAATGAAGCTCATGGG + Intronic
1094796911 12:33985118-33985140 TCAGTCAGGAAGTAGATCACAGG - Intergenic
1095109656 12:38279051-38279073 TCAGTCAGGAAGTAGATCACAGG - Intergenic
1095375300 12:41520079-41520101 ACAGTGTGGAGGAAGAGAAGAGG - Intronic
1096711831 12:53463127-53463149 TCAGTGTGCAAGAATAGAAGGGG + Intronic
1096943729 12:55380375-55380397 TCAGTTTAGAAGAAAGTCAGAGG + Intergenic
1097258066 12:57695671-57695693 TGAGTGTGTAAGTAGATGAGAGG + Intronic
1100952066 12:99862313-99862335 TCAGAGTGGAAAAACATCAAAGG + Intronic
1101700668 12:107170728-107170750 TGAGGGTGGAAGAAGATTTGTGG + Intergenic
1102096394 12:110244861-110244883 TCAGTTTGGAAGGTAATCAGGGG - Intergenic
1103093413 12:118113865-118113887 TCACTGGGGAAGAAGACTAGGGG - Intronic
1103322881 12:120102010-120102032 TCAGGGTGGCAGAGGTTCAGAGG - Intronic
1103832727 12:123793193-123793215 TCAGTGTGCATGAAGGTGAGGGG - Intronic
1104060161 12:125261012-125261034 TCAGTGAGGCAGAAGATGACTGG - Intronic
1104227795 12:126852782-126852804 TCTGTGTGCAAGAACATCACTGG + Intergenic
1104615426 12:130264250-130264272 ACAGTGGGGATGACGATCAGAGG + Intergenic
1104715644 12:131014372-131014394 TCAGTGTGAAACCAGATCAAAGG - Intronic
1107157122 13:37181415-37181437 TCAGAGTGAAAACAGATCAGAGG - Intergenic
1107190412 13:37577560-37577582 TGAGTGGGGAAGAAGTTCATTGG + Intronic
1108673295 13:52713439-52713461 TCACTGTGGAAGAAAATCCAGGG - Intronic
1112957537 13:105079838-105079860 TCAGTGTAGAAGAAAAACTGAGG + Intergenic
1113150755 13:107261263-107261285 ACAGTGTGGAGTAAGAGCAGAGG - Intronic
1116028855 14:39546839-39546861 GCAGTGTGCAAGAAGATAAGAGG + Intergenic
1117617647 14:57550076-57550098 TCAGTGTTGAGAAAGATCAGGGG - Intergenic
1119105454 14:71919188-71919210 TCAGAGGGGGAGAAGAGCAGAGG + Intergenic
1119517643 14:75260888-75260910 TCAGTGTGGATGAAGAAGAGGGG + Intronic
1124709746 15:31997970-31997992 TCAGAAGGAAAGAAGATCAGTGG + Intergenic
1125252385 15:37720330-37720352 TCAGTGAGGCAGAAGATTTGAGG - Intergenic
1126360014 15:47836478-47836500 AAAGTGAGGAAGCAGATCAGTGG + Intergenic
1127319383 15:57827724-57827746 GCAGTGTGGGAGAAGAGCAGAGG - Intergenic
1127916570 15:63459968-63459990 ACACTGTGGAAGAAGATCCTAGG - Intergenic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1139294355 16:65887279-65887301 TAAGTGAGGAAGATGAGCAGGGG + Intergenic
1140794942 16:78428439-78428461 ACAGTGAGGAAGGAAATCAGGGG + Intronic
1140828514 16:78729458-78729480 TCCTTATGGAAGAAGGTCAGAGG + Intronic
1142625904 17:1191719-1191741 GGGGTGTGGAAGAAGAACAGAGG + Intronic
1144560502 17:16316983-16317005 TCAGACTGGAAGAATACCAGAGG - Intronic
1146676218 17:34775372-34775394 TGAGTGTGACAGAAGGTCAGGGG - Intergenic
1148068195 17:44889079-44889101 TCAGTGCGGAGGAAAACCAGGGG + Intronic
1148936796 17:51169614-51169636 CCAGTCTGGAATAGGATCAGTGG - Intronic
1150543359 17:66127378-66127400 CCAGTGTGGGAGAAGAGCACAGG - Intronic
1151404007 17:73875160-73875182 TCAGAGAGGAAGGAGGTCAGCGG + Intergenic
1151782195 17:76254559-76254581 ACACTGTGGAAGAATATCTGAGG + Intergenic
1152719009 17:81913677-81913699 TGAGTGTGGAGGAAGCTCTGAGG - Intronic
1153413096 18:4815986-4816008 ACAGTGTGGAAGAGGACCAGAGG - Intergenic
1153781672 18:8500350-8500372 TGAGTCTGGAAGAAGCTGAGAGG - Intergenic
1155284671 18:24275409-24275431 TCAGAGTGGAAGGAGATCTGAGG + Intronic
1155614320 18:27703269-27703291 TAGCTGTGGAAGAAGATCTGAGG - Intergenic
1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG + Intergenic
1157462509 18:47912191-47912213 GCACTGTGGCAGAAGATGAGGGG + Intronic
1158237515 18:55334803-55334825 TCAGTGACTAAGAAGCTCAGAGG + Intronic
1163501191 19:17677304-17677326 TCAGTGTGGGAGAAGATTGGGGG - Intronic
1163887323 19:19978043-19978065 TCAGTGTGGGTGAAGATGTGGGG - Intergenic
1163950701 19:20582413-20582435 TCAGTGTGGGTGAAGATGTGGGG - Intronic
1164514605 19:28923054-28923076 TGAGTGTGGCAGAAGATGACCGG + Intergenic
1165064059 19:33218989-33219011 TCAGAGTGGAACAGGATGAGGGG + Intronic
1165223497 19:34337423-34337445 TCAGTCTGGAAGAGGGTCTGAGG + Intronic
1168072527 19:53960909-53960931 TGCATGTGGAAGAAGATGAGGGG + Intergenic
925664580 2:6238974-6238996 TCAGAGAGGAAGAAGGTCACTGG - Intergenic
926548557 2:14272426-14272448 TGAGTGTGGAAGGGGATCACAGG - Intergenic
930420734 2:51150948-51150970 ACACTGTGGAAGAAGATCCAAGG + Intergenic
930875817 2:56214418-56214440 ACACTGTAGATGAAGATCAGTGG + Intronic
933546516 2:83720181-83720203 TGAGTGTGGAAGAAGATATTAGG - Intergenic
934487467 2:94729372-94729394 TCAGTGTCAAAGAAGAACACTGG - Intergenic
934921783 2:98349677-98349699 TAAGTGTGGAATCAGAACAGAGG - Intronic
938705546 2:133921483-133921505 TCAGATAGGAAAAAGATCAGTGG - Intergenic
945885129 2:215367480-215367502 TCAGTGTTGAATGAGATCAGAGG - Intronic
946480106 2:220047312-220047334 TCAGTTTGGAAGAACATCAGTGG + Intergenic
948494591 2:238339227-238339249 GCAGTGTGAAAGATGATCTGTGG + Intronic
1170416949 20:16154321-16154343 ACAATATGGAAGAAGAACAGAGG + Intergenic
1170764557 20:19279145-19279167 TCACTGTGGAAGTAGAGGAGAGG + Intronic
1171060219 20:21949462-21949484 AAAGTGTGGAAAAAGATGAGTGG + Intergenic
1176379791 21:6106493-6106515 GCAGAGGGGAAGAAGAGCAGAGG - Intergenic
1177366362 21:20143097-20143119 TCAGTGTGAATGAATGTCAGAGG - Intergenic
1177937438 21:27367186-27367208 TCAATGTGGAACAAGAGAAGTGG - Intergenic
1178378857 21:32091902-32091924 TCAGTTTGGAAGGAGAGGAGAGG - Intergenic
1179743683 21:43431744-43431766 GCAGAGGGGAAGAAGAGCAGAGG + Intergenic
1184397322 22:44250408-44250430 ACAGTGTGGAAACAGATCTGCGG + Intronic
1185109237 22:48891647-48891669 TCTCTGAGGAAGAAGAGCAGTGG + Intergenic
1203240260 22_KI270733v1_random:10357-10379 TCAGTGTAGAATGAGAACAGTGG + Intergenic
949375511 3:3384863-3384885 TCAGTGTGGAAGAAGTTGAGTGG - Intergenic
950195821 3:11008430-11008452 ACAATGTGGAAGAAGGCCAGAGG - Intronic
950857956 3:16122915-16122937 TCAGTCTGGAAGAAGAGGAAAGG + Intergenic
951405226 3:22289122-22289144 TAAGCCTGGAAGAAGATCTGTGG + Intronic
952912862 3:38205317-38205339 TCTGTGGGGAAGATGATCAGTGG + Intronic
955453295 3:59093722-59093744 TTAGTGGGGAACAAGATTAGAGG - Intergenic
957146128 3:76426108-76426130 TCAATGTGGATGAAGAGGAGAGG + Intronic
959208313 3:103342178-103342200 CCTGGGTGGAAAAAGATCAGTGG + Intergenic
960406402 3:117265590-117265612 GCACTGTGGAAGAAGATTTGAGG - Intergenic
960740397 3:120826898-120826920 TCAGTCTGAAAGAAGAGCTGCGG + Intergenic
961207403 3:125095919-125095941 TCAGTCTTTAAGAAGATCACTGG - Intronic
963091079 3:141484678-141484700 TCAGTGTGGCTGGAGATCAGAGG + Intergenic
964157052 3:153599178-153599200 ACAGTGTGGAAGCGGATGAGGGG + Intergenic
967278313 3:187798061-187798083 TAAGTCTGGAAGAAGTGCAGTGG - Intergenic
968699291 4:2047122-2047144 TCCGTGGGGAGGAAGAACAGGGG - Intergenic
969170480 4:5358608-5358630 TCCTTGTGGAAGGAGATCATTGG + Intronic
969189088 4:5502499-5502521 CCAGTGTGGAAAAAGCTCAAGGG - Intergenic
969492464 4:7507706-7507728 TCAGTGGGGAAAAATGTCAGTGG + Intronic
971774283 4:30941400-30941422 TCAGTCTTGAATAAGATTAGCGG - Intronic
971815873 4:31488062-31488084 TCATTGTGGAAGTAGAGCACTGG - Intergenic
972464585 4:39342924-39342946 TAACTGTGGAGGAAGATTAGAGG - Intronic
973550093 4:52025501-52025523 CCAGTGTGGAAGAAGCACGGAGG + Intronic
973822485 4:54674999-54675021 TCAGTGGGGGAAAAAATCAGAGG - Intronic
974737765 4:65960723-65960745 GCAGTGTGAAAGAAGAGGAGGGG + Intergenic
975489362 4:74971677-74971699 TCAGAGAGGAAGGAGATCTGAGG - Intronic
975617154 4:76257817-76257839 TCATTGTGGGAGGAGCTCAGTGG - Intronic
975713996 4:77188265-77188287 TCAAAGTGGAATAAGATAAGTGG + Intronic
976169372 4:82286984-82287006 GCAGTTTGGGAGAAGAGCAGAGG + Intergenic
976392434 4:84518912-84518934 TCAATGTGGAAGATGAACACAGG - Intergenic
977094031 4:92715599-92715621 TCATGGTGGAAGAAGATGAAAGG + Intronic
978583540 4:110255374-110255396 TCAGTCAGGAAGAAGAACAGAGG - Intergenic
978984025 4:114986415-114986437 TCAGAGTGGACTAAAATCAGTGG - Intronic
979164992 4:117517488-117517510 CCATTCTGGAAGAAGATAAGGGG + Intergenic
979343012 4:119550460-119550482 TAAGTGTGGCTGAAGATGAGTGG + Intronic
979761397 4:124409165-124409187 TGAGTTTGTAAGCAGATCAGAGG - Intergenic
979836982 4:125382608-125382630 TCAGAATGGTAAAAGATCAGTGG + Intronic
979993892 4:127408130-127408152 TCTGTGAGGATGAATATCAGGGG - Intergenic
981382587 4:144090462-144090484 TCAGAGGAGCAGAAGATCAGAGG + Intergenic
981746235 4:148055059-148055081 TCAGTGTGGAATCAGGTAAGAGG - Intronic
983073411 4:163295609-163295631 TGAATGTGGAAGAAGAGCAGTGG + Intergenic
984555464 4:181208804-181208826 TGGCTGTGGAGGAAGATCAGAGG + Intergenic
984625433 4:182002280-182002302 TCAGAGTTGATGAAGACCAGGGG + Intergenic
985066689 4:186129270-186129292 TCAGTGTGGAGCAAAAACAGAGG - Intronic
985490381 5:175410-175432 TCAGTGTGGGAGAAGGTCTGGGG - Intronic
988977833 5:36533032-36533054 TCTGAGAGGAAGCAGATCAGTGG + Intergenic
989375519 5:40756156-40756178 TCAGTGGGGAACAAGGTGAGGGG + Intergenic
991134628 5:63167018-63167040 TCAGTGGGGAAGAAAATCTGGGG - Intergenic
991411535 5:66350964-66350986 TCTGTATGGAATAAGATCAAAGG - Intergenic
992269230 5:75049283-75049305 GCAAAGTGGAAGAAGACCAGAGG - Intergenic
993524508 5:88947763-88947785 ACAGTGAGAAAGGAGATCAGGGG + Intergenic
994180516 5:96758776-96758798 TCTGTATGGAAGACGATGAGAGG - Intronic
995169402 5:109090006-109090028 TCAGGAGGGAAGAAGATGAGTGG + Intronic
997002904 5:129783849-129783871 TTTCTGTGGAGGAAGATCAGTGG - Intergenic
997644193 5:135469233-135469255 CCAGTTTGGAAGAAGAGAAGAGG + Intergenic
997701879 5:135907994-135908016 ACAGTCAGGAAGAGGATCAGGGG - Intergenic
999175678 5:149630256-149630278 TGAGCGGGGAAGAAGTTCAGTGG + Intronic
1001001402 5:168010780-168010802 TCCGTGTGGGAGATGAGCAGGGG + Intronic
1001522854 5:172407318-172407340 TCAGGGTGGAAGATGATGACTGG + Intronic
1002280315 5:178125856-178125878 TTATTGTGAAAGCAGATCAGTGG - Exonic
1002625802 5:180528109-180528131 TAAGTGTGAAAAAAAATCAGTGG - Intronic
1002789773 6:428498-428520 TCAGTGGGGAAGATGCCCAGCGG + Intergenic
1003514176 6:6804573-6804595 GCGGTGTGGAAGAGGTTCAGGGG - Intergenic
1004176213 6:13342390-13342412 TCAGTGAGGAAGAAGACCGATGG + Intergenic
1005632916 6:27725559-27725581 TGAGTGTGGAATAAGATCCCAGG + Intergenic
1006463130 6:34175557-34175579 TCTGTGGGGGAGATGATCAGTGG + Intergenic
1006884038 6:37365198-37365220 ACAGTGTGGACGAATCTCAGAGG + Intronic
1007109338 6:39304034-39304056 TCCATGTGGGAGAAGAGCAGCGG + Exonic
1007314343 6:40973423-40973445 TGAGAGTGGAAGAAGAGAAGAGG - Intergenic
1008539985 6:52538118-52538140 TCCCTGTGAAGGAAGATCAGAGG + Intronic
1008705113 6:54148335-54148357 TCAGTGTTGTAGAATATCTGAGG - Intronic
1008787081 6:55181672-55181694 TCACTGTGGAAGAAAAGCATGGG + Intronic
1011095483 6:83657253-83657275 TCAGTGTGGAAGAACAGCATGGG + Intronic
1012703839 6:102496494-102496516 ACAGAGTGGAAGAGGCTCAGTGG + Intergenic
1012717849 6:102699390-102699412 TCTGTGGGGAGGATGATCAGTGG + Intergenic
1013802715 6:113966092-113966114 TCAGTGTGGAAAAGGAAAAGTGG + Intronic
1014148685 6:118028255-118028277 ATAGTGTGGAAGAAGAACACAGG - Intronic
1016039709 6:139420255-139420277 GCAGCGTGGAAGAAGAGAAGGGG - Intergenic
1016822752 6:148361789-148361811 CCAGTGTGGAAGAAGAAGACAGG + Intronic
1018409872 6:163533532-163533554 TCAATGTGGAACAAGAAAAGAGG - Intronic
1018696287 6:166393992-166394014 TCTGTGAGGAAGACAATCAGTGG - Intergenic
1021076998 7:16317233-16317255 CCAATGTGGAAGAAGCTGAGAGG - Intronic
1021598358 7:22340631-22340653 TCAGTGTGGAGGAAGGGCTGTGG - Intronic
1024162686 7:46694226-46694248 TTAGTGAAGAGGAAGATCAGCGG + Intronic
1024313912 7:47995437-47995459 ACAGCCTGGAATAAGATCAGTGG + Intronic
1024598086 7:50956473-50956495 TCCCTCTGGAGGAAGATCAGAGG + Intergenic
1024655669 7:51449474-51449496 ACTGTGTGGAAGGAGTTCAGAGG + Intergenic
1027508415 7:79048217-79048239 TCAGAATGGTAAAAGATCAGAGG + Intronic
1027662834 7:81007839-81007861 TAAGTGTTAAAGAAGCTCAGTGG + Intergenic
1028820823 7:95210070-95210092 TCAGTGGGAAAAAAGATCACTGG + Intronic
1029647653 7:101868495-101868517 TCAGTGTGTAAGATGAGCAAAGG - Intronic
1031714737 7:125094819-125094841 TTAATGTGGAAGAAGGTCAGAGG + Intergenic
1032285066 7:130533519-130533541 TCAGTGAGGGAGAAGGTGAGAGG + Intronic
1035312530 7:157978765-157978787 TCACTGTGACAGAAAATCAGGGG - Intronic
1035414932 7:158674976-158674998 TCAGGGGGAAAAAAGATCAGTGG + Intronic
1036040597 8:5076029-5076051 TGAGTGCGGAACAAGTTCAGAGG + Intergenic
1036935619 8:12999343-12999365 TCAGGGTGGGAGAAGATGGGAGG + Intronic
1037735386 8:21561783-21561805 GCAGAGTGGAGGCAGATCAGTGG - Intergenic
1039196831 8:35041593-35041615 TCAATGTGGGAGAATATCGGGGG - Intergenic
1039409856 8:37343683-37343705 TCAGAGGGGAAGAAGTTTAGAGG - Intergenic
1040663151 8:49598488-49598510 ACAGTGTGGTAGAAGGTCTGTGG - Intergenic
1040787963 8:51189094-51189116 TCAGTGCTGAACAGGATCAGAGG - Intergenic
1041392794 8:57361717-57361739 TAAGTGTGGAACAAGGTCACAGG + Intergenic
1044019947 8:87093765-87093787 TAAGTATGGGAGAAGATCTGGGG - Intronic
1044463898 8:92481523-92481545 TCAAGGTGGACGAAGATCAGAGG + Intergenic
1044711338 8:95061222-95061244 TCAGTGTTTCAGTAGATCAGGGG - Intronic
1046562566 8:115856475-115856497 TCAATTTGGAAAAAAATCAGAGG - Intergenic
1047715450 8:127590927-127590949 TGGGGGTGGAAGAAGATCTGGGG + Intergenic
1050892959 9:10848514-10848536 TCAGTGTAAAAGATGAACAGAGG - Intergenic
1051666326 9:19470091-19470113 ACAGTTTGGAAGAAGAAAAGTGG - Intergenic
1053670339 9:40355058-40355080 TCAGTGTCAAAGAAGAACACTGG + Intergenic
1053920128 9:42981321-42981343 TCAGTGTCAAAGAAGAACACTGG + Intergenic
1054381459 9:64495043-64495065 TCAGTGTCAAAGAAGAACACTGG + Intergenic
1054514274 9:66021242-66021264 TCAGTGTCAAAGAAGAACACTGG - Intergenic
1055001504 9:71455198-71455220 TCAATGTGCAAGAAGATGAAAGG + Intergenic
1055344363 9:75318932-75318954 TCACTGTGGAATAAGAACACAGG - Intergenic
1056130795 9:83584559-83584581 TCTTTATGGAAGAAGATGAGTGG - Intergenic
1056879913 9:90381198-90381220 TCAATTTTGAATAAGATCAGTGG + Intergenic
1057560239 9:96122388-96122410 GCATTGTGGGAGAAGCTCAGGGG + Intergenic
1058775709 9:108281432-108281454 ACAGTGAGGAAGAAGAGCATGGG - Intergenic
1059552094 9:115239449-115239471 TCCATGTGGAGGAAGAACAGAGG + Intronic
1059858193 9:118425418-118425440 TCAGTTTGAAAGAGGATCAGTGG + Intergenic
1060302455 9:122383302-122383324 TCAGAGTGGAAGATGAGCGGGGG + Intronic
1061811616 9:133165422-133165444 GCAGAGTGGGAGAAGAGCAGTGG + Intergenic
1185891847 X:3828812-3828834 TCAGTGTGGAAGAAGATCAGAGG - Intronic
1185896954 X:3867226-3867248 TCAGTGTGGAAGAAGATCAGAGG - Intergenic
1185902072 X:3905652-3905674 TCAGTGTGGAAGAACATCAGAGG - Intergenic
1188663548 X:32790684-32790706 TCAGTGTGCATGAAGTTGAGTGG - Intronic
1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG + Intergenic
1191976262 X:66875039-66875061 TTAGTGGGGGAGATGATCAGGGG - Intergenic
1193347279 X:80418604-80418626 TCAGTGAGAAAGAAGATAGGAGG - Intronic
1194097395 X:89658718-89658740 ACAGGGTGGAAAAAGAGCAGTGG - Intergenic
1194755078 X:97729595-97729617 TCAGAGAGGAACAAGATCAGAGG - Intergenic
1195480627 X:105340618-105340640 TCAGGGTGGAAGAGCATCACAGG - Intronic
1196068643 X:111494573-111494595 ACTGTTTGGAAGATGATCAGAGG + Intergenic
1196236176 X:113283354-113283376 TCAGTTTGGGATAAGATCTGGGG - Intergenic
1196253376 X:113487424-113487446 TAAGTCTGGATGTAGATCAGTGG - Intergenic
1196616290 X:117769977-117769999 ACAGTGTGGAAGGGGACCAGAGG - Intergenic
1200450412 Y:3320095-3320117 ACAGGGTGGAAAAAGAGCAGTGG - Intergenic