ID: 1185893199

View in Genome Browser
Species Human (GRCh38)
Location X:3837984-3838006
Sequence GTCACCGCCTCGTGTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 3, 1: 0, 2: 1, 3: 9, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185893199_1185893202 2 Left 1185893199 X:3837984-3838006 CCAAGGGAACACGAGGCGGTGAC 0: 3
1: 0
2: 1
3: 9
4: 85
Right 1185893202 X:3838009-3838031 CTGGGAGCACCCGTCTTCACTGG 0: 3
1: 0
2: 1
3: 13
4: 101
1185893199_1185893207 17 Left 1185893199 X:3837984-3838006 CCAAGGGAACACGAGGCGGTGAC 0: 3
1: 0
2: 1
3: 9
4: 85
Right 1185893207 X:3838024-3838046 TTCACTGGGTGATTCCTCCAGGG 0: 1
1: 2
2: 0
3: 9
4: 148
1185893199_1185893208 18 Left 1185893199 X:3837984-3838006 CCAAGGGAACACGAGGCGGTGAC 0: 3
1: 0
2: 1
3: 9
4: 85
Right 1185893208 X:3838025-3838047 TCACTGGGTGATTCCTCCAGGGG 0: 1
1: 2
2: 1
3: 16
4: 115
1185893199_1185893206 16 Left 1185893199 X:3837984-3838006 CCAAGGGAACACGAGGCGGTGAC 0: 3
1: 0
2: 1
3: 9
4: 85
Right 1185893206 X:3838023-3838045 CTTCACTGGGTGATTCCTCCAGG 0: 1
1: 2
2: 2
3: 25
4: 164
1185893199_1185893203 3 Left 1185893199 X:3837984-3838006 CCAAGGGAACACGAGGCGGTGAC 0: 3
1: 0
2: 1
3: 9
4: 85
Right 1185893203 X:3838010-3838032 TGGGAGCACCCGTCTTCACTGGG 0: 3
1: 0
2: 1
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185893199 Original CRISPR GTCACCGCCTCGTGTTCCCT TGG (reversed) Intronic
901639524 1:10686349-10686371 GGCCCCACCTCGTGCTCCCTTGG - Intronic
901811425 1:11768901-11768923 GCCCCTGCCTGGTGTTCCCTTGG + Intronic
906201604 1:43963992-43964014 GCCATCCCCTCATGTTCCCTTGG - Intronic
906561053 1:46757244-46757266 GTCACCGCCTTCTGGTCCCTTGG - Intergenic
906898201 1:49802715-49802737 GTCACCGCCTTCTGGTCCCGTGG - Intronic
910831613 1:91467141-91467163 GTCACCGCCTTCTGGTCCCATGG - Intergenic
917459889 1:175220935-175220957 GTGCCCGCCTCGTGATCCCTTGG - Intergenic
921975344 1:221196685-221196707 GTCACCGCCTTCTGGTCCCATGG + Intergenic
924950867 1:248882170-248882192 GTCACCGCCTTCTGGTCCCACGG + Intergenic
1070162503 10:73874529-73874551 GTCTCCTCCTCTTGCTCCCTCGG - Exonic
1072386827 10:94939281-94939303 GTCACCGCCTTCTGGTCCCATGG + Intronic
1072441824 10:95463829-95463851 GTCACTGCCTTGTGGGCCCTGGG - Intronic
1076846634 10:133072412-133072434 GTCACAGCCTCGGGCTCCCTGGG - Intronic
1081450621 11:43167873-43167895 GTCACCACCTCCTGGTCCCATGG + Intergenic
1084767453 11:71322023-71322045 GTCACCCCCTGGTGGTCCCTGGG - Intergenic
1086700437 11:89895613-89895635 GCCTCCGCCTGGTGTTCCTTTGG - Intergenic
1086705732 11:89948913-89948935 GCCTCCGCCTGGTGTTCCTTTGG + Intergenic
1088753284 11:112864200-112864222 GTCTCTGCCTAGTCTTCCCTTGG + Intergenic
1099212297 12:79806660-79806682 GTCAACGTCTTGTTTTCCCTGGG - Intronic
1099600349 12:84727866-84727888 GACACTGCCAAGTGTTCCCTGGG - Intergenic
1101315243 12:103623100-103623122 CTCACATCCTCGTGTTTCCTGGG - Intronic
1106099538 13:26682557-26682579 GTGACCCTCTCTTGTTCCCTTGG + Intronic
1114599668 14:23944191-23944213 GTCACCGCCTTTTGGTCCCGTGG + Intergenic
1118961779 14:70539893-70539915 GTCACCGCCTTCTGGTCCCATGG - Intergenic
1119615657 14:76097134-76097156 GTCACCCCCTTGGATTCCCTTGG - Intergenic
1121489190 14:94345864-94345886 GTCATCGCCAGATGTTCCCTGGG - Intergenic
1121758358 14:96422038-96422060 GTCACCGCCTTCTGGTCCCGTGG + Intronic
1122517246 14:102317528-102317550 ATCACCGCCTAGTGTTCCCTGGG + Intronic
1123208143 14:106733581-106733603 GTCACCGCCTTCTGGTCCCATGG - Intergenic
1128751826 15:70155550-70155572 GTCCCGGCCACCTGTTCCCTGGG - Intergenic
1129446903 15:75625281-75625303 GCCCCCGCCTCGCGTCCCCTGGG + Intronic
1129567734 15:76641449-76641471 GTCATCGCCTTGTGGTCCCGTGG - Intronic
1142788183 17:2241937-2241959 GACATTGCCACGTGTTCCCTGGG - Intronic
1144819998 17:18065753-18065775 GCCTCCGCCTCTTGTGCCCTTGG - Exonic
1150331461 17:64297699-64297721 TTCACCTCCTCTTGTGCCCTGGG + Intergenic
1154479795 18:14809069-14809091 ATCACAGCCTTGTGTTCCCGTGG + Intronic
1159118776 18:64145427-64145449 GTCACCGCCTTCTGGTCCCATGG - Intergenic
1161026719 19:2040372-2040394 GGCCCAGCCTCGGGTTCCCTGGG - Intronic
1161156532 19:2734707-2734729 GGCATCGCCCAGTGTTCCCTGGG + Intronic
1163953389 19:20612035-20612057 GTCACCACCTCCAGTTTCCTAGG - Intronic
1165075271 19:33276850-33276872 GGCAGCCCCTTGTGTTCCCTTGG + Intergenic
925090092 2:1148370-1148392 GACATCACCTCGTGTTCCCAGGG + Intronic
925276000 2:2648934-2648956 GTCTGCGTCCCGTGTTCCCTCGG + Intergenic
929811567 2:45193261-45193283 CTCCCTGCCTCGGGTTCCCTGGG - Intergenic
936842161 2:116784154-116784176 TTCACAGCCTTGTGTTTCCTGGG - Intergenic
941894816 2:170618650-170618672 GTCACCGCCTTCTGGTCCCATGG + Intronic
948590574 2:239047184-239047206 GTCCCTGTCTCGTCTTCCCTGGG - Intergenic
1169314885 20:4582229-4582251 GTCTCCACCTCCTGTTCCCTGGG + Intergenic
1174961243 20:55159482-55159504 CTCACCGCCTTGTTTTCTCTTGG + Intergenic
1175258710 20:57662130-57662152 GACATCGCCACATGTTCCCTGGG - Intronic
1176800745 21:13427233-13427255 ATCACAGCCTTGTGTTCCCGTGG - Intergenic
1178605686 21:34034758-34034780 CTCACTGGCTCCTGTTCCCTAGG - Intergenic
1179897435 21:44370532-44370554 GTCACAGGCCAGTGTTCCCTGGG - Intronic
1181310205 22:21940535-21940557 GTCTCTGCCTCATGTTCCCCTGG - Intronic
1184148484 22:42624977-42624999 TTCAACACCCCGTGTTCCCTGGG - Intronic
1184586966 22:45454417-45454439 GTCACTGCCTCCTGGGCCCTGGG + Intergenic
955146106 3:56321521-56321543 GCCTCCCCCTTGTGTTCCCTTGG - Intronic
975619508 4:76281882-76281904 GTCACCGCCTTCTGGTCCCACGG + Intronic
976413179 4:84740689-84740711 GTCACATCCTCGTGTTCTCAGGG - Intronic
976636444 4:87291129-87291151 GTCACCGCCTTCTGGTCCCGCGG + Intergenic
980661434 4:135864074-135864096 GTCACCGCCTTCTGGTCCCATGG + Intergenic
985491279 5:181296-181318 GTTACTGCCTCGGGCTCCCTGGG + Intronic
986583709 5:9292796-9292818 GACACTTCCACGTGTTCCCTGGG - Intronic
990013814 5:51033198-51033220 GTTACAACCTCTTGTTCCCTGGG - Intergenic
992818693 5:80471582-80471604 GTCACCGCCTTCTGGTCCCGTGG - Intronic
993016416 5:82539648-82539670 GTTACTGTCTCGTGTTCCCTGGG + Intergenic
999682497 5:154073112-154073134 GTCACCGCCTTTTGGTCCCGCGG + Intronic
1002929670 6:1624540-1624562 GTCTCCCCCTCTTCTTCCCTAGG - Exonic
1006705044 6:36012647-36012669 GACATCGCCACATGTTCCCTGGG + Intronic
1007719694 6:43877833-43877855 GTCACAGCCTCCCGTCCCCTTGG - Intergenic
1008621668 6:53277144-53277166 GTAATCACCTCTTGTTCCCTGGG - Intronic
1012476401 6:99618907-99618929 CTCACAGCCTCGCGCTCCCTGGG + Intergenic
1012476419 6:99618976-99618998 CTCACAGCCTCGCGCTCCCTGGG + Intergenic
1012476424 6:99618999-99619021 CTCACAGCCTCGCGCTCCCTGGG + Intergenic
1017738099 6:157381586-157381608 GCCGCCGCCTCGTGTCCCCTCGG + Exonic
1019413022 7:914805-914827 GTCACCGCCTGCTGGTCCCCAGG + Intronic
1028707735 7:93869983-93870005 GTCACCGCCTTCTGGTCCCACGG + Intronic
1029464824 7:100718904-100718926 GTCACCGCCTTCTGGTCCCGTGG - Intergenic
1032974453 7:137206318-137206340 GTCACCGCCTTCTGGTCCCATGG - Intergenic
1033424036 7:141227124-141227146 GTCACTGCTCTGTGTTCCCTGGG - Intronic
1034709433 7:153177863-153177885 GTCACTGCCTCCAGTTGCCTTGG + Intergenic
1037812526 8:22095447-22095469 GACATTGCCTCATGTTCCCTGGG + Intronic
1039449084 8:37657260-37657282 GTCACCAGCTCTTCTTCCCTGGG - Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1048304998 8:133278046-133278068 GTCAGCTCCTTGTGTTCCCCAGG - Intronic
1048422268 8:134288869-134288891 GTCACCGCCTTCTGGTCCCGCGG - Intergenic
1048431938 8:134378623-134378645 GTCACCGCCTTCTGGTCCCATGG + Intergenic
1056264117 9:84878938-84878960 CTCACTGCCTCGTCTTCCCTTGG + Intronic
1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG + Exonic
1060345196 9:122809803-122809825 GTCACCGCCTTCTGGTCCCGTGG - Intronic
1185893199 X:3837984-3838006 GTCACCGCCTCGTGTTCCCTTGG - Intronic
1185898311 X:3876406-3876428 GTCACCGCCTCGTGTTCCCTTGG - Intergenic
1185903426 X:3914835-3914857 GTCACCGCCTCGTGTTCCCTTGG - Intergenic
1189479506 X:41381841-41381863 GCCACTGCCTGGTGTTCCCTCGG + Intergenic
1193565498 X:83071159-83071181 GTCACCGCCTTCTGGTCCCGTGG - Intergenic
1198267690 X:135024582-135024604 GTCACCGCCTTCTGGTCCCGCGG - Intergenic
1199602795 X:149552622-149552644 GTCACCGCCTTCTGCTCCCACGG + Intergenic
1199647594 X:149926853-149926875 GTCACCGCCTTCTGCTCCCACGG - Intergenic