ID: 1185894151

View in Genome Browser
Species Human (GRCh38)
Location X:3843468-3843490
Sequence GCGTCCCCATGAAGGCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 3, 1: 1, 2: 1, 3: 6, 4: 61}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185894151_1185894161 3 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894161 X:3843494-3843516 CAGGTCCGGGGCGCCGGGCCGGG 0: 4
1: 2
2: 4
3: 41
4: 438
1185894151_1185894167 18 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894167 X:3843509-3843531 GGGCCGGGCCGGAGCGCTCGGGG 0: 3
1: 1
2: 6
3: 40
4: 299
1185894151_1185894158 -3 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894158 X:3843488-3843510 CGCACTCAGGTCCGGGGCGCCGG 0: 3
1: 2
2: 1
3: 7
4: 100
1185894151_1185894159 -2 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894159 X:3843489-3843511 GCACTCAGGTCCGGGGCGCCGGG 0: 4
1: 1
2: 1
3: 5
4: 111
1185894151_1185894157 -9 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894157 X:3843482-3843504 TGGGGACGCACTCAGGTCCGGGG 0: 4
1: 1
2: 1
3: 7
4: 75
1185894151_1185894156 -10 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894156 X:3843481-3843503 ATGGGGACGCACTCAGGTCCGGG 0: 4
1: 1
2: 2
3: 5
4: 101
1185894151_1185894169 24 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894169 X:3843515-3843537 GGCCGGAGCGCTCGGGGAGCCGG 0: 4
1: 2
2: 3
3: 27
4: 241
1185894151_1185894165 16 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894165 X:3843507-3843529 CCGGGCCGGGCCGGAGCGCTCGG 0: 3
1: 3
2: 1
3: 49
4: 319
1185894151_1185894166 17 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894166 X:3843508-3843530 CGGGCCGGGCCGGAGCGCTCGGG 0: 3
1: 3
2: 2
3: 41
4: 320
1185894151_1185894160 2 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894160 X:3843493-3843515 TCAGGTCCGGGGCGCCGGGCCGG 0: 3
1: 0
2: 4
3: 13
4: 201
1185894151_1185894162 7 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894162 X:3843498-3843520 TCCGGGGCGCCGGGCCGGGCCGG 0: 3
1: 1
2: 12
3: 87
4: 4190
1185894151_1185894170 25 Left 1185894151 X:3843468-3843490 CCCGGGCGCCTTCATGGGGACGC 0: 3
1: 1
2: 1
3: 6
4: 61
Right 1185894170 X:3843516-3843538 GCCGGAGCGCTCGGGGAGCCGGG 0: 4
1: 1
2: 1
3: 22
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185894151 Original CRISPR GCGTCCCCATGAAGGCGCCC GGG (reversed) Exonic
900166664 1:1246731-1246753 CCGTCCCCATGACTGCGCCCTGG - Intergenic
900309110 1:2024863-2024885 GCATCCCCAGGAAGGGACCCAGG + Intronic
900342948 1:2197302-2197324 GCTCCCCCATGCAGGTGCCCTGG + Intronic
900517939 1:3091991-3092013 CCCTCCCCATGAAGCCGTCCTGG - Intronic
904405160 1:30283697-30283719 GCGTCCCCAGCAAGGGCCCCGGG + Intergenic
919729225 1:200902224-200902246 GCTTCCCCATGACTGCTCCCAGG - Intronic
1062877431 10:954338-954360 GCGTCCACATGTAGGAGGCCTGG - Intergenic
1069718037 10:70533113-70533135 TCGTCCCCATGGAGGTGCTCAGG + Intronic
1076523521 10:131095480-131095502 GCGTCCCCATGCAGGCGACGTGG - Intronic
1076841345 10:133047361-133047383 GCCTCCCCATGCAGGAGCACAGG + Intergenic
1077149084 11:1060639-1060661 GCGTCCCCATGTCAGCGGCCTGG - Intergenic
1078600230 11:12724092-12724114 GCATCACCATGAAGGAGCCTGGG - Intronic
1080517372 11:33037036-33037058 GGGTCCCCAAGAAGGCGTCATGG - Intergenic
1083986039 11:66216127-66216149 GCATCCTAATGAAGGCGCACTGG + Exonic
1084374084 11:68764200-68764222 GCTGCCCCAAGAAGGGGCCCGGG + Intronic
1085280409 11:75326263-75326285 GCGTCCCCAGAAAGCAGCCCAGG + Intronic
1092755381 12:11758379-11758401 GCTTCCCCATGCAGGAGCCAAGG + Intronic
1094814087 12:34166773-34166795 GCGTCCCCAGCAGGGAGCCCAGG + Intergenic
1097712632 12:62933377-62933399 GGGTCAGCATCAAGGCGCCCAGG + Intronic
1113775658 13:112943586-112943608 GAGGCCCCGTGCAGGCGCCCAGG + Intronic
1113811583 13:113146036-113146058 GCGCCCCCATGAATTCCCCCAGG + Intronic
1115670816 14:35609805-35609827 GCCTCCCCAAGTAGGGGCCCTGG - Intronic
1118854469 14:69610708-69610730 TCCTCCCCATCAAGGCGCCACGG + Intergenic
1127753443 15:62068033-62068055 GGGTCCCCAGGAGGGCGTCCGGG - Exonic
1129312928 15:74725116-74725138 GCTTCCCCATCAAGGCCACCTGG - Intronic
1132021175 15:98363986-98364008 GGGTCCCCATGAAGAGGCACAGG - Intergenic
1135796217 16:25445295-25445317 GCCTCCCCCTGAAAGCTCCCAGG - Intergenic
1141997895 16:87646954-87646976 GGGTTCCCATTAAGGAGCCCAGG + Intronic
1145811300 17:27765762-27765784 GCCTGCCCATCAAGGAGCCCTGG - Intronic
1146750424 17:35373615-35373637 GCGTTTCCCTGGAGGCGCCCAGG + Exonic
1149685382 17:58531876-58531898 GGGTCCCCTTGCAGCCGCCCGGG + Intronic
1152111838 17:78360941-78360963 GCGTCCGCCAGAGGGCGCCCTGG + Intergenic
1152418260 17:80177069-80177091 GCACCCCCATGAAGGCTCCAGGG + Intronic
1154294412 18:13136696-13136718 GCGTCCCCAGCAGCGCGCCCAGG - Intergenic
1157601336 18:48894839-48894861 GCCTCCCCAGGAAGGGGCTCTGG - Intergenic
1161273621 19:3403934-3403956 GCGTCCCCATGGAGAGGCTCCGG - Intronic
1163559598 19:18010771-18010793 GCCACCCCATCAAGGCTCCCAGG - Intronic
1166541205 19:43607344-43607366 GGTTCCCCAAGAAGGAGCCCAGG + Exonic
926012843 2:9422652-9422674 GCGTCCCCTGCCAGGCGCCCTGG - Exonic
928888234 2:36174623-36174645 GCGTCCCCAAGGAGGCACGCAGG + Intergenic
938092324 2:128441730-128441752 GCGTCCCCTGGACGGCTCCCTGG - Intergenic
938190678 2:129277425-129277447 GCCTCCCCATGAAGTCTCCCTGG - Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948183495 2:236001237-236001259 GGCTCCCCATGAAGGCTCCCCGG - Intronic
1168891068 20:1295642-1295664 GCGTCTCCATGAACGTGCTCAGG - Intronic
1175947920 20:62567270-62567292 GGGACCCCATGAAGATGCCCCGG - Intronic
1180959076 22:19754601-19754623 ACGTTCCCAGGAAGGGGCCCAGG - Intergenic
1183158661 22:36095265-36095287 GCAGCCCCATGAAGGCACCACGG - Intergenic
1184562579 22:45271950-45271972 GCCTCCCCAGGAAACCGCCCGGG + Intergenic
1185069801 22:48649729-48649751 GTGTCCCCGAGAAGGCGCCCCGG - Intronic
954638842 3:52086100-52086122 GCGCCCCCATGATGTCTCCCTGG + Intronic
956313436 3:67907514-67907536 GCTTCCCCATGAAGACTTCCAGG - Intergenic
961839485 3:129696950-129696972 GCCACCCCATGAAAGCACCCAGG - Intronic
973845996 4:54913979-54914001 GCCTGCCCTTGAAGGCGTCCTGG + Intergenic
985022596 4:185708038-185708060 TCTTCCCCTTGAAGGAGCCCAGG + Intronic
991956982 5:72004888-72004910 AAGTCCCCATGAAGGCACCCAGG + Intergenic
1007911107 6:45514776-45514798 GCTCCCCCAAGAAGGCTCCCAGG - Intronic
1013638301 6:112049213-112049235 GCCTCCCCATGCAGCAGCCCGGG - Intergenic
1020118118 7:5487713-5487735 GGGGCCCCAGGCAGGCGCCCTGG + Intronic
1023761246 7:43467280-43467302 GCCTCCCCAAGAATGCTCCCTGG - Intronic
1026665347 7:72336446-72336468 ACGTCCCCAGGCAGGCGGCCAGG + Intronic
1037845062 8:22275584-22275606 GCGGCCCCAAGAAGGTGTCCAGG + Intronic
1039898055 8:41730236-41730258 GCAGCCCCATGAGGCCGCCCTGG + Intronic
1053440034 9:38108576-38108598 GCCTCCCCATGACTGTGCCCAGG + Intergenic
1062059406 9:134486824-134486846 GCGTCCCCATGAACACTCGCCGG - Intergenic
1062354911 9:136157394-136157416 CCGTCCCCATTTAGGAGCCCTGG + Intergenic
1185877599 X:3713239-3713261 GCGTCCCCATGGAGGCGCCCGGG - Exonic
1185894151 X:3843468-3843490 GCGTCCCCATGAAGGCGCCCGGG - Exonic
1185899270 X:3881892-3881914 GCGTCCCCATGAAGGCGCCCGGG - Intergenic
1185904387 X:3920321-3920343 GCGTCCCCATGAAGGCGCCCGGG - Intergenic
1200097876 X:153672610-153672632 GCATCCCCAAGAAGGCCCTCCGG - Exonic
1200787707 Y:7274305-7274327 GCCTCCCCATGGAGGCGCCCGGG + Intergenic