ID: 1185898311

View in Genome Browser
Species Human (GRCh38)
Location X:3876406-3876428
Sequence GTCACCGCCTCGTGTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185898311_1185898320 18 Left 1185898311 X:3876406-3876428 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185898320 X:3876447-3876469 TCACTGGGCGATTCCTCCAGGGG No data
1185898311_1185898314 2 Left 1185898311 X:3876406-3876428 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185898314 X:3876431-3876453 CTGGGAGCACCCGTCTTCACTGG No data
1185898311_1185898315 3 Left 1185898311 X:3876406-3876428 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185898315 X:3876432-3876454 TGGGAGCACCCGTCTTCACTGGG No data
1185898311_1185898318 16 Left 1185898311 X:3876406-3876428 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185898318 X:3876445-3876467 CTTCACTGGGCGATTCCTCCAGG No data
1185898311_1185898319 17 Left 1185898311 X:3876406-3876428 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185898319 X:3876446-3876468 TTCACTGGGCGATTCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185898311 Original CRISPR GTCACCGCCTCGTGTTCCCT TGG (reversed) Intergenic