ID: 1185898463

View in Genome Browser
Species Human (GRCh38)
Location X:3877061-3877083
Sequence ACTCGGCCCAGAGGTTGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185898463_1185898469 12 Left 1185898463 X:3877061-3877083 CCTCGACAACCTCTGGGCCGAGT No data
Right 1185898469 X:3877096-3877118 GCAAGTCGCTCCTGCCCGCATGG No data
1185898463_1185898471 14 Left 1185898463 X:3877061-3877083 CCTCGACAACCTCTGGGCCGAGT No data
Right 1185898471 X:3877098-3877120 AAGTCGCTCCTGCCCGCATGGGG No data
1185898463_1185898470 13 Left 1185898463 X:3877061-3877083 CCTCGACAACCTCTGGGCCGAGT No data
Right 1185898470 X:3877097-3877119 CAAGTCGCTCCTGCCCGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185898463 Original CRISPR ACTCGGCCCAGAGGTTGTCG AGG (reversed) Intergenic