ID: 1185899270

View in Genome Browser
Species Human (GRCh38)
Location X:3881892-3881914
Sequence GCGTCCCCATGAAGGCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185899270_1185899284 16 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899284 X:3881931-3881953 CCGGGCCGGGCCGGAGCGCTCGG No data
1185899270_1185899276 -9 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899276 X:3881906-3881928 TGGGGACGCACTCAGGTCCGGGG No data
1185899270_1185899279 2 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899279 X:3881917-3881939 TCAGGTCCGGGGCGCCGGGCCGG No data
1185899270_1185899278 -2 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899278 X:3881913-3881935 GCACTCAGGTCCGGGGCGCCGGG No data
1185899270_1185899288 24 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899288 X:3881939-3881961 GGCCGGAGCGCTCGGGGAGCCGG No data
1185899270_1185899280 3 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899280 X:3881918-3881940 CAGGTCCGGGGCGCCGGGCCGGG No data
1185899270_1185899286 18 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899286 X:3881933-3881955 GGGCCGGGCCGGAGCGCTCGGGG No data
1185899270_1185899289 25 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899289 X:3881940-3881962 GCCGGAGCGCTCGGGGAGCCGGG No data
1185899270_1185899285 17 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899285 X:3881932-3881954 CGGGCCGGGCCGGAGCGCTCGGG No data
1185899270_1185899277 -3 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899277 X:3881912-3881934 CGCACTCAGGTCCGGGGCGCCGG No data
1185899270_1185899275 -10 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899275 X:3881905-3881927 ATGGGGACGCACTCAGGTCCGGG No data
1185899270_1185899281 7 Left 1185899270 X:3881892-3881914 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185899281 X:3881922-3881944 TCCGGGGCGCCGGGCCGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185899270 Original CRISPR GCGTCCCCATGAAGGCGCCC GGG (reversed) Intergenic
No off target data available for this crispr