ID: 1185901834

View in Genome Browser
Species Human (GRCh38)
Location X:3904022-3904044
Sequence CTGCCAGGGTTGGGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 3, 1: 1, 2: 3, 3: 70, 4: 668}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185901834 Original CRISPR CTGCCAGGGTTGGGGAAAAA GGG Intergenic
900520204 1:3101707-3101729 CAGCCAGGGGTGGGGAAAAATGG + Intronic
901121168 1:6895302-6895324 GTGTCTGGGATGGGGAAAAAAGG - Intronic
901187444 1:7384151-7384173 GTGCCAGGGATGTGGGAAAAGGG + Intronic
901727918 1:11256887-11256909 CAGCCAGGCTTGGGGAACGATGG - Intronic
902354289 1:15885809-15885831 CTGCCACTGATGGGAAAAAAAGG - Intronic
902394344 1:16124570-16124592 CCGCCAGGGCTGGGGACAGAGGG - Exonic
902414180 1:16229383-16229405 CTTCCGGGGCTGGGGAGAAACGG + Intergenic
903299370 1:22367381-22367403 CTGCTGGGGTTGTGGAGAAAAGG + Intergenic
903309090 1:22438652-22438674 TTGGCAAGGTTGTGGAAAAACGG - Intergenic
903804982 1:25998828-25998850 TGGCCAGGCTTGGGGGAAAAGGG + Intergenic
904037511 1:27566806-27566828 CTGCTAGGGTGGGGGGAAGAAGG + Intronic
904210195 1:28882236-28882258 TTGCCAGGGTGAGGGAAAGACGG - Intergenic
905271642 1:36791344-36791366 CTGCATGGGTTGGGGAGAATGGG + Intergenic
905382556 1:37573443-37573465 CTGCCAGGGTGAGGGAAATGGGG + Intronic
906737709 1:48148200-48148222 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
906882954 1:49612735-49612757 CTGCCAAGGTTGTGGAGAAAAGG + Intronic
906958946 1:50403239-50403261 CTGGCATGGTTGTGGAGAAAAGG + Intergenic
907050777 1:51328959-51328981 TAGCCAGGGTTGGGGACAGATGG + Intronic
907085326 1:51667366-51667388 CTGGGAGGGTTGGGGTGAAATGG - Intronic
907141299 1:52187809-52187831 CTGACAAGGTTGTGGAGAAAAGG + Intronic
907918128 1:58889237-58889259 CTATCAGAGGTGGGGAAAAAAGG - Intergenic
907972094 1:59393144-59393166 CAGGCAGGGTTGGGGAGAAGAGG - Intronic
908762427 1:67524542-67524564 CTGCCTGGGTAGGAGACAAAAGG - Intergenic
908807032 1:67942520-67942542 GTGTCAGGGGTGGGGAAAACAGG - Intergenic
908864820 1:68535710-68535732 CTGGCAAGGTTGGGGAGAAAAGG + Intergenic
908949074 1:69537409-69537431 AAGCTAGGGTTGGGGAAAGAGGG + Intergenic
909060721 1:70876073-70876095 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
909304976 1:74062411-74062433 CTGCCAAGGTTGTGGAGGAAAGG + Intronic
909442724 1:75716168-75716190 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
909471826 1:76037754-76037776 ATGGCAGGGATGAGGAAAAATGG + Intergenic
909490673 1:76222907-76222929 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
910848189 1:91624222-91624244 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
911526588 1:98995010-98995032 CTGGCAAGGTTGCAGAAAAAAGG + Intronic
911900432 1:103496522-103496544 CTGCCAAGGTTGTGGAGAAAAGG + Intergenic
912451169 1:109768606-109768628 GTGCCAGGGCTGGGGAAAGCAGG - Intronic
912705755 1:111910693-111910715 CTGCCTGGGTTGTGGTACAAAGG + Intronic
912778340 1:112521371-112521393 TTGCCAGGTTTGGGGAGACATGG + Exonic
912931481 1:113967359-113967381 CTGCCAAGGATATGGAAAAAAGG - Intronic
914033017 1:143975404-143975426 CTGCCCGGCTTGGGGGGAAAGGG - Intergenic
914156428 1:145092562-145092584 CTGCCCGGCTTGGGGGGAAAGGG + Intronic
914256471 1:145964121-145964143 GTACCAGGGTTGGGGAGACAGGG - Intronic
914899509 1:151704224-151704246 CAGCCAGGATTGGGGGGAAAGGG + Intronic
915665116 1:157437469-157437491 CAGCCAGGGTTGGGGAAAAAAGG - Intergenic
916423560 1:164659663-164659685 CTGCCAGGGAGAGGGAACAAGGG - Intronic
917172839 1:172196541-172196563 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
917349862 1:174065611-174065633 CTGGCAAGGATGTGGAAAAAAGG + Intergenic
917572505 1:176282845-176282867 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
917826455 1:178826539-178826561 TTGCCAGGGATGGGGAGAAATGG + Intronic
917929926 1:179816082-179816104 CTGCCAGGATTAGGGCAAGAGGG - Exonic
918759959 1:188391462-188391484 TTGACAGGGTTGTGGAGAAAGGG + Intergenic
918981705 1:191569894-191569916 CTGGCAGGGTTGCAGAGAAAAGG + Intergenic
919698807 1:200610023-200610045 TTGCCAGGGATTGGGAAGAAGGG + Intronic
919965002 1:202514026-202514048 CTGGCAAGGTTGCAGAAAAAAGG - Intronic
919981173 1:202643667-202643689 CTGCCAGCGGAGGGGAAAATGGG + Intronic
919995475 1:202744654-202744676 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
920003191 1:202813101-202813123 CTGCCAGGAAAGAGGAAAAAGGG - Intergenic
920894221 1:210028431-210028453 CTGCCAGGGTTGGGGGAAGGGGG - Intronic
921241649 1:213190286-213190308 CTGGCAAGGATGTGGAAAAAAGG - Intronic
921634879 1:217480497-217480519 CTGGCAGGGATGTGGAGAAAAGG + Intronic
921767301 1:218987306-218987328 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
921769079 1:219013136-219013158 CTCCCAGGTTTGGGGCAACAAGG + Intergenic
922407448 1:225330160-225330182 CTGACAGGGATGTGGAGAAAAGG + Intronic
922868223 1:228879024-228879046 CTGGCAAGGTTGCGGAGAAAAGG + Intergenic
923466831 1:234255756-234255778 CTGGAAGGGTTGGGGATGAAGGG + Intronic
924283480 1:242461724-242461746 CTGGCAAGGCTGGGGAGAAAGGG - Intronic
924658356 1:245993727-245993749 ATGCCAGGGCTGGGGGAATAGGG + Intronic
924819694 1:247476925-247476947 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1062906579 10:1183637-1183659 CAGGCAGGGTTGGGGACAGAGGG + Intronic
1063752216 10:8963124-8963146 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1065653018 10:27913840-27913862 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1066679375 10:37922183-37922205 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1066717065 10:38297902-38297924 ATGCTAGGGATGGGGAAAAGTGG - Intergenic
1067148597 10:43711527-43711549 CTTCCAGGCTGGGGGATAAAGGG - Intergenic
1067232098 10:44419147-44419169 CTTCCAGGCTGTGGGAAAAAAGG - Intergenic
1067639204 10:48030496-48030518 CAGCCAGGGCTGCAGAAAAATGG - Intergenic
1067993747 10:51245372-51245394 GTGCCAGGGTTTGGGGGAAAGGG - Intronic
1068702811 10:60037928-60037950 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1068772026 10:60832481-60832503 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1069207044 10:65702808-65702830 CTGGCAAGGCTGAGGAAAAAAGG + Intergenic
1069440474 10:68423881-68423903 CTGCCATGGTAGGGGAAGAGGGG - Intronic
1069583356 10:69579880-69579902 GCACCAGGGTTGGGGAAAAGAGG - Intergenic
1069789188 10:71008784-71008806 CCACCAGTGTTGGGGAAAAGTGG + Intergenic
1069960046 10:72074113-72074135 CTGTCAGGTCTGGGGGAAAAGGG + Intronic
1070058436 10:72957335-72957357 CTGCCAGGGGCTGGGGAAAAGGG - Intergenic
1070273038 10:74976372-74976394 TTTTCAGGGTTGGGGAGAAAGGG - Intronic
1070998953 10:80812692-80812714 CTGTCAGGGGTAGGGGAAAAAGG - Intergenic
1071410496 10:85387691-85387713 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1071825928 10:89325944-89325966 CTGGCAAGGATGTGGAAAAAAGG + Intronic
1072228487 10:93392258-93392280 CTCCCAGGGTTGTGGTAAGAAGG - Intronic
1074087791 10:110221831-110221853 CTGCCCGAGCTGGGGAGAAAGGG - Intronic
1074278301 10:112025552-112025574 CTGCCAGGTTTGGGGAAGACAGG + Intergenic
1075456686 10:122589486-122589508 CTGCCTTGGTAGGGGAACAAAGG - Intronic
1075764718 10:124884315-124884337 CTGCAAAGGTTGGGGTAAGAGGG + Intergenic
1076690041 10:132219029-132219051 CTGCCAGGGGAGGGGAGAAGAGG + Intronic
1076907346 10:133369655-133369677 CTTCCAGGGTGGGGGAAGAGAGG - Intronic
1077607680 11:3623027-3623049 ATGCCAGGGATGGGGAAGAAGGG - Intergenic
1078302528 11:10147075-10147097 CTGACAAGGTTGTGGAGAAAAGG + Intronic
1079066042 11:17293873-17293895 TTGCCAGGGGATGGGAAAAAAGG + Intronic
1079454725 11:20626554-20626576 CAGCCAGGGCTGGGGAAGCAGGG - Intronic
1079454797 11:20626889-20626911 CTGGGAGGCTTGGGCAAAAAGGG + Intronic
1079958354 11:26891695-26891717 CTGCCAAGGTTGCAGAGAAAAGG + Intergenic
1080023474 11:27588936-27588958 CTGGCAGGGCTGTGGAGAAAAGG - Intergenic
1080973886 11:37311678-37311700 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1081695871 11:45108717-45108739 CAGGCAGGGCTGGGGAGAAATGG - Intronic
1081981747 11:47270789-47270811 CTGGCAGGGTTGGGGTAGAGGGG - Intronic
1082732040 11:56810612-56810634 CTGACAAGGTTGTGGAGAAAAGG - Intergenic
1082755297 11:57069115-57069137 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1082777923 11:57262151-57262173 CTGGCAAGGTTGCGGAGAAAAGG + Intergenic
1085149774 11:74241142-74241164 CTGGGAGGGTTGGGGAGAAATGG - Intronic
1085246514 11:75106197-75106219 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1085901642 11:80707366-80707388 CTGTCAAGGTTGTGGAGAAAAGG + Intergenic
1085990466 11:81836835-81836857 CTGCCAAGGATGTGGAGAAATGG - Intergenic
1086226494 11:84517501-84517523 CTGGCAAGGATGTGGAAAAAAGG + Intronic
1087694362 11:101359234-101359256 CTGGCAAGGATGTGGAAAAAAGG + Intergenic
1087842767 11:102937023-102937045 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1088386054 11:109257617-109257639 TTGCCAGGGTCTGGGAGAAATGG - Intergenic
1088409313 11:109515794-109515816 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1088701495 11:112417035-112417057 ATGCCAGGGCTGGGGAAAAGAGG + Intergenic
1089343066 11:117772789-117772811 CTGGCAGGGTTGGGGTAAGAGGG - Intronic
1089361188 11:117887734-117887756 CAGCCAGGGGTGGGCAGAAATGG + Intergenic
1089587492 11:119519736-119519758 CTGCCAGGTTTGGAGAGAATGGG + Intergenic
1090249968 11:125244401-125244423 CTGGAAGGGTTGGGGATAAGGGG - Intronic
1090614880 11:128505752-128505774 CTGCCTGGGTAGGTGAGAAAGGG + Intronic
1090729452 11:129557551-129557573 CTGCCAGGCTGGGGGAAACCAGG + Intergenic
1090743044 11:129683637-129683659 CTGGCAAGGATGGGAAAAAATGG - Intergenic
1090948067 11:131449072-131449094 CTCCCAGGGAAGGGGAAGAAGGG + Intronic
1091077793 11:132637259-132637281 CTGCCAGGATTGGAAAAAAACGG - Intronic
1091920700 12:4302462-4302484 ATGCCAGGGGAGGGGAAAGACGG - Exonic
1092636771 12:10459564-10459586 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1092727024 12:11496920-11496942 CCGCCAGGGATGGGGAAACAAGG - Intronic
1093134361 12:15432637-15432659 CTGGCAAGGTTGCGGAGAAAAGG - Intronic
1093175342 12:15907057-15907079 AGACCAAGGTTGGGGAAAAATGG + Intergenic
1093780925 12:23136487-23136509 CTGGCAAGGTTGTGGACAAAAGG - Intergenic
1094145086 12:27220317-27220339 CTGTCAGGGAGGGGGAAATAAGG + Intergenic
1094262229 12:28514095-28514117 CTGGCAAGGTTGAGGAGAAAAGG - Intronic
1094420598 12:30266847-30266869 CTGGCAGGGATGTGGAGAAAGGG + Intergenic
1096597160 12:52703167-52703189 CTGCCAGGGTGGGGGAGTAGGGG - Exonic
1096881721 12:54678512-54678534 CTGGCAGTGTTGGGGTAGAATGG + Intergenic
1097212077 12:57379045-57379067 TTGCCAGGGCTGGGGGAAAGGGG + Intronic
1097224635 12:57470294-57470316 CTGCAAGTGATGGGGAGAAAAGG - Intronic
1097248658 12:57620564-57620586 CTGGCAGGGTTGGGCAAGGAGGG - Intronic
1097455279 12:59792485-59792507 CTGCCAGGTTTGGAGAATAAAGG - Intergenic
1097542863 12:60962066-60962088 CTGTCAAGGTTGTGGAGAAAAGG - Intergenic
1097761071 12:63464991-63465013 CTGGCAAGGTTGTGGAGAAAGGG - Intergenic
1097807139 12:63978361-63978383 TTGGGAGGGTTGGGGAAAAATGG - Intronic
1097929456 12:65168408-65168430 CTGCCAAGGTTTGGGGAAATGGG + Intergenic
1098013154 12:66075879-66075901 TTGGTAGGGTTGGGGAACAAAGG + Intergenic
1098145632 12:67495156-67495178 CTGGCAAGGTTGCGGAGAAAAGG + Intergenic
1098798757 12:74926208-74926230 CTGGCAAGGTTGTGGAAAAAGGG + Intergenic
1098989025 12:77044282-77044304 ATGCAGGGGGTGGGGAAAAAAGG + Intronic
1099805032 12:87507941-87507963 CTGACAGGGTTGGGAGCAAAGGG - Intergenic
1100060544 12:90569799-90569821 CTGGCAGGGATGTGGAGAAAAGG - Intergenic
1100197224 12:92260551-92260573 ATGCCAGTGTTGGAGAAAATGGG - Intergenic
1101238014 12:102809476-102809498 TTGCCAGTGTTGGAAAAAAAAGG - Intergenic
1101388946 12:104282664-104282686 CTGCAAGGGTTGGGGCACATGGG + Intronic
1102754973 12:115331914-115331936 TTGCCAAGGCTGGGGAAAGAGGG + Intergenic
1103221903 12:119253200-119253222 CTGCTATGTTTGGGGAAACAAGG - Intergenic
1103728779 12:123012520-123012542 CTACCAGGTGTGGGGAAAAGGGG + Intronic
1104074274 12:125375916-125375938 CCGCCAGGGAAGGGGAAAAATGG + Intronic
1104933737 12:132353715-132353737 CTTCCAGGGTGGGGGAAATGTGG - Intergenic
1104943473 12:132405418-132405440 GAGCCAGGGCTGGGGACAAAGGG - Intergenic
1105317750 13:19282718-19282740 CTGCCGGGGTTGGGGGCAAGGGG + Intergenic
1105443468 13:20434079-20434101 CTGCCAGGGTTGGGGACCATGGG - Intronic
1105918658 13:24940786-24940808 CTGCCAGTGTTGGGAAAGAAAGG + Intergenic
1105934605 13:25087632-25087654 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1107228652 13:38082121-38082143 CTGGCAAGGATGTGGAAAAAAGG + Intergenic
1107482137 13:40794009-40794031 CTGCTAGTGTTGGGAAAGAAAGG + Intronic
1107561125 13:41558488-41558510 TTGCCTGGGTTGGGGAACATGGG + Intergenic
1108141901 13:47432301-47432323 CTGTCAGGGGTTGGGGAAAAGGG + Intergenic
1108158471 13:47612890-47612912 CTGACAAGGTTGTGGAGAAAAGG - Intergenic
1108656752 13:52540928-52540950 CTGTCGGGGTTGGGGGAAAGGGG - Intergenic
1108849783 13:54714216-54714238 CTGTCAGGGTTGGGGGGAAAGGG - Intergenic
1109022397 13:57114780-57114802 CTGACAGGGTTGTGGAGAAAAGG - Intergenic
1109047070 13:57426088-57426110 CTTCTAGGGATGGGGAAAAATGG + Intergenic
1109105570 13:58245859-58245881 CTGGCAAGGTTGAGGAGAAAAGG + Intergenic
1109448257 13:62473840-62473862 CTGCCAGGGATTGGGCAATATGG - Intergenic
1109843192 13:67948424-67948446 CTGTAAGTGTTGGGGAAACATGG + Intergenic
1109884238 13:68522926-68522948 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1109905373 13:68832413-68832435 CTGTCAAGGTTGTGGAGAAAAGG - Intergenic
1110328361 13:74243102-74243124 CTGTCAGGGGTGGGGGACAAGGG - Intergenic
1110418614 13:75279358-75279380 CTGCAGGGATTGGGGAAAAGGGG + Intergenic
1110802784 13:79719132-79719154 CTGGCAAGGTTGTGGAAAAAAGG - Intergenic
1110959244 13:81599823-81599845 CTGCCACCATTTGGGAAAAATGG + Intergenic
1112169264 13:96952809-96952831 TTGCCAGGTTTGGAGAGAAAGGG - Intergenic
1112667721 13:101595703-101595725 TTGGCAGGGTTGTGGAGAAAAGG + Intronic
1112755134 13:102624273-102624295 CTCCCAGGGTAGGGGGAAAAAGG + Intronic
1112957667 13:105081253-105081275 TTGGCAGGGTTGTGGAGAAAAGG - Intergenic
1113244585 13:108380227-108380249 CTGGCAAGGTTGCAGAAAAAGGG - Intergenic
1113540756 13:111107023-111107045 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1113703879 13:112412087-112412109 CTGGCAAGGATGGGGAAAAAGGG - Intronic
1114169103 14:20253792-20253814 CTGACAGGGGTAGGGAAAAGAGG + Intergenic
1114359359 14:21953683-21953705 CTGGCAAGGTTGGGGAGAAAAGG - Intergenic
1114409894 14:22490856-22490878 CTGCAAGTGTTTGGGAGAAATGG + Intergenic
1114416379 14:22547441-22547463 CAGCCTGGGTTGGGGCAAAGAGG + Intergenic
1115861747 14:37694431-37694453 CTGGCAGGGATGTGGAGAAAAGG + Intronic
1116025314 14:39507300-39507322 CTGATAGAGTTGGGGAAACAAGG - Intergenic
1116163029 14:41293980-41294002 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1116588153 14:46736311-46736333 CTGGCAAGGTTGTGGTAAAAAGG - Intergenic
1117239700 14:53817459-53817481 GTTCCTGGGTGGGGGAAAAAAGG + Intergenic
1118115046 14:62766182-62766204 CTGACAAGGATGTGGAAAAACGG + Intronic
1119586656 14:75842232-75842254 CTGGCAAGGGTGTGGAAAAAGGG - Intronic
1120410206 14:84144836-84144858 CTGTCAGGGGTGGGGAGCAAGGG - Intergenic
1121001894 14:90456927-90456949 CTGCCGGGGATGGGGAAGGAGGG + Intergenic
1121088916 14:91167887-91167909 ATGACAGGGTTGGGGAAGAAAGG - Intronic
1121969370 14:98342444-98342466 ATGCAAGGGTGGGGGAGAAAAGG + Intergenic
1122144991 14:99683860-99683882 CGGGCAGGTTTGGGGGAAAAAGG + Intergenic
1122380104 14:101296937-101296959 CTGGCAAGGTTGCGGAGAAAAGG + Intergenic
1123979315 15:25585070-25585092 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1124993023 15:34694576-34694598 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1125247802 15:37661424-37661446 CTGACAAGGTTGTGGAGAAAAGG - Intergenic
1125382875 15:39105696-39105718 CTGGCAAGGTTGAGGAGAAAAGG - Intergenic
1125780801 15:42265343-42265365 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1125937505 15:43649292-43649314 CTGCCAAGGCGGGGGAAGAAGGG + Intronic
1126300194 15:47185641-47185663 CGGCCAGGGTGGGGGAGCAATGG - Intronic
1126395925 15:48217562-48217584 CTGACAGTATTGGGAAAAAATGG - Intronic
1127697767 15:61468621-61468643 CTGCCAGGGTTGGGAACCACTGG + Intergenic
1127837575 15:62802710-62802732 CTGGCAGGGATGTGGAGAAAAGG - Intronic
1127889568 15:63237369-63237391 CTGGCAGGGATGTGGAGAAAAGG - Intronic
1128512245 15:68320455-68320477 GCCCCAGGGTTGGGGCAAAAAGG + Intronic
1130123503 15:81072604-81072626 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1130162243 15:81413594-81413616 CTTCCAGGGCTGGGGAAATTGGG + Intergenic
1130527323 15:84718385-84718407 CTGGGAGAGTTGGGGAAAATGGG + Intergenic
1130695029 15:86122675-86122697 CTGTCAAGGTTGTGAAAAAAAGG + Intergenic
1130726412 15:86444088-86444110 CTGGCAAGGTTGTGGAGAAAGGG - Intronic
1132230446 15:100179678-100179700 CTGGCAAGGTTGTGGAAAAAAGG - Intronic
1133819965 16:9227265-9227287 CTGCGGGGGTGGGGGTAAAATGG + Intergenic
1134150581 16:11801574-11801596 CTACCAGGGGTGGGGGAATAGGG - Intergenic
1134598022 16:15511317-15511339 CTGCCAGGGAAGGGTGAAAAGGG - Intronic
1134887904 16:17810694-17810716 CTGTCGGGGGTGGGGGAAAAGGG - Intergenic
1135469268 16:22714726-22714748 CTGGCAAGGTTGTGGACAAAAGG - Intergenic
1135890990 16:26357166-26357188 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1136779257 16:32886452-32886474 CTGCCAGGAGCGGGGAGAAAGGG - Intergenic
1136891360 16:33975066-33975088 CTGCCAGGAGCGGGGAGAAAGGG + Intergenic
1137310363 16:47250885-47250907 ATGCCAGGGCTGAGGAAAGAAGG + Intronic
1137408271 16:48207145-48207167 CTCCCAGTGTTGGGGGAACAAGG + Intronic
1137679917 16:50332500-50332522 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1138082280 16:54101798-54101820 CTGGCGAGGTTGGGGAGAAAAGG - Intronic
1138218200 16:55224193-55224215 TTGCCAGGGGTGGGGGTAAAAGG + Intergenic
1138872379 16:60906828-60906850 GTGCCAGGTTTTGGGTAAAAAGG - Intergenic
1139195191 16:64910133-64910155 CTGCAAGGGTTTGGGGAAACAGG + Intergenic
1139580875 16:67873021-67873043 CTGCCAGGGCCGGAGAAGAAAGG - Exonic
1139963199 16:70729661-70729683 CTGTAATGGTTGGGGAAAGAAGG - Intronic
1142031152 16:87839204-87839226 CTCCCAGGGCTGGGGGAACAGGG - Intronic
1203081673 16_KI270728v1_random:1148540-1148562 CTGCCAGGAGCGGGGAGAAAGGG - Intergenic
1143447298 17:7017041-7017063 CTGACGGGGTTGGGGAGAAAGGG + Intronic
1143891990 17:10109450-10109472 CTGCCAAGGATGAGGAAAGATGG + Intronic
1144092264 17:11868751-11868773 CTGCTTGAGTTGGAGAAAAATGG - Intronic
1144543013 17:16163972-16163994 CTGCCAGGGGTTGGGGAAAAGGG + Intronic
1144617060 17:16786410-16786432 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1144895632 17:18529264-18529286 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1146277569 17:31525029-31525051 CAGCCTGGGTTGGGGTGAAATGG + Intronic
1146622526 17:34410414-34410436 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1146654833 17:34628989-34629011 CTGCCAGGGTAGGGGAGGGAAGG - Intronic
1146930667 17:36775445-36775467 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1147753843 17:42755065-42755087 CAGCCAGGGTTGGAGAAGGAAGG + Intergenic
1148114955 17:45170119-45170141 CTGCCAGGCTTGGGGCAGCAGGG - Intergenic
1149148452 17:53529373-53529395 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1149165788 17:53750420-53750442 CTTAGAGGGTTGGGGGAAAAGGG - Intergenic
1149220462 17:54411180-54411202 CTGTCAAGGTTGTGGAGAAAAGG + Intergenic
1149377966 17:56064626-56064648 CTGCCTGGGTGGGGGAAAGGTGG - Intergenic
1149659939 17:58328923-58328945 CTGACAGGGTCGGGGACAGAAGG + Intergenic
1149716477 17:58795360-58795382 CTGGCAAGGTTGTGGCAAAAAGG - Intronic
1149765194 17:59270155-59270177 GGGCCAGAGTTAGGGAAAAAAGG + Intronic
1150618093 17:66787661-66787683 CTTCCAGGGTGGTGGAAACATGG - Intronic
1151029599 17:70721355-70721377 CTGGCAAGGATGTGGAAAAAAGG - Intergenic
1151041369 17:70864561-70864583 CTGCCAGGGTTGAGCATAGATGG - Intergenic
1151051577 17:70984449-70984471 CTGGCAGGCTAAGGGAAAAATGG - Intergenic
1151140759 17:71990052-71990074 TTGCCAAGGTGGCGGAAAAAGGG - Intergenic
1151150175 17:72078128-72078150 CTACCAGGGCTGGGGAATAAGGG - Intergenic
1151453636 17:74213857-74213879 CTGGGAGGGTGGGGGAAAAGGGG - Intronic
1152385261 17:79970263-79970285 CTGCCAGGGCTGGGGAAGGAAGG + Intronic
1153391062 18:4560127-4560149 CTGTCAGGGTTGGGGTCAAGGGG - Intergenic
1154183062 18:12154452-12154474 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1154309784 18:13258190-13258212 CTGTCTTGGTTGGGAAAAAATGG - Intronic
1155200231 18:23510832-23510854 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1155672892 18:28393600-28393622 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1155758470 18:29532973-29532995 CTGGCATGATTGTGGAAAAAAGG + Intergenic
1155782189 18:29850357-29850379 CTGCTAGGGTTGGGGAGGGATGG + Intergenic
1155861748 18:30910209-30910231 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1156444561 18:37225806-37225828 CAGCCTGGGTTGGGGAACAGGGG - Intronic
1156885422 18:42130124-42130146 TTGCCAGGGTTGGGGAAAGGAGG + Intergenic
1156993924 18:43443610-43443632 GTGCCTGGGTTGGGGAAAGGCGG + Intergenic
1158546037 18:58397964-58397986 CAGCCAGGGCAGGGTAAAAACGG - Intronic
1158690665 18:59657412-59657434 CTGTCAGGGTTGGATACAAATGG - Intronic
1159562357 18:70008793-70008815 CTGAGAGTGATGGGGAAAAATGG + Intronic
1159924639 18:74256854-74256876 CTGACACAGTAGGGGAAAAAAGG + Intronic
1160078439 18:75700823-75700845 CTGCCAGGTTTGGGAGGAAAGGG + Intergenic
1160120510 18:76126470-76126492 CTTACAGGGTTGGGGACAAGAGG + Intergenic
1160252858 18:77218849-77218871 CTGCCAGGCTTTGGGAGGAAGGG - Intergenic
1160261787 18:77300955-77300977 CCCCCAGGTATGGGGAAAAATGG - Intergenic
1160305634 18:77733001-77733023 CTGACAAAGATGGGGAAAAAAGG - Intergenic
1161720189 19:5898046-5898068 CTGCCAGGGATGGGCCACAAGGG + Intronic
1161926809 19:7306915-7306937 CTGCCAGGAGAGGGGAAAGAGGG + Intergenic
1162192075 19:8954812-8954834 CTGCCAGGATGGGGGAAGTAGGG + Exonic
1162495006 19:11018646-11018668 CTGCCAGGGCTGGGGAAGCCTGG - Intronic
1162529847 19:11229473-11229495 CAGACAGGGATGGGGAAAAGAGG + Intronic
1163074423 19:14876654-14876676 TTGGCAGGGTTGGGGAGGAAAGG - Intergenic
1163248752 19:16113215-16113237 CTGCTAGGGATGGGGAAAGTGGG + Intronic
1164048253 19:21561546-21561568 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1164284015 19:23794336-23794358 CTGTCAGGGTTGCAGAGAAAAGG - Intronic
1164620628 19:29694090-29694112 CTGGCAGGGCTGAGGGAAAACGG - Intergenic
1166413378 19:42572768-42572790 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1166422054 19:42644478-42644500 CTGTCAAGGTTGTGGAGAAAAGG - Intronic
1166750641 19:45162605-45162627 CTGCCAGGGCTGGGGATGCATGG - Intronic
1166901205 19:46064924-46064946 CTGGCAGGGATGTGGAGAAAAGG - Intronic
1166996471 19:46721943-46721965 CCACCAGGGTTGGGGAGAAGGGG - Intronic
1167588381 19:50388153-50388175 CTGCCAGGGGTGGGGGCAGATGG + Intronic
1167755082 19:51407720-51407742 CTGCAAGGGCTTGAGAAAAAGGG - Intergenic
1168155310 19:54471109-54471131 CTGCCAGGGCTCGGGACAGAGGG + Intronic
1168280357 19:55302377-55302399 CTCCCAGGTTTGAGGGAAAAAGG + Intronic
1168310093 19:55455848-55455870 GTGCCAGTGATGGGGAAGAAAGG + Intronic
925973843 2:9126909-9126931 CTACCAGGGATGGGGAGAGATGG + Intergenic
927022970 2:19036610-19036632 CTGACAGAGATGGGGCAAAAGGG - Intergenic
927461704 2:23305001-23305023 GTACCAGGGTGGGGGAAAAGAGG - Intergenic
928893765 2:36237606-36237628 AAGTCAGGGTTGGGGATAAATGG - Intergenic
929764604 2:44833578-44833600 AAGCCAAGGTTGAGGAAAAATGG + Intergenic
929779226 2:44947045-44947067 CTGCTGGGGATGGGGACAAAAGG - Intergenic
930894777 2:56432894-56432916 CTGGCAGGGATGTGGAGAAAAGG - Intergenic
931171436 2:59807654-59807676 GTGCCTGGGTTTGGGAAAAGAGG - Intergenic
931214115 2:60225730-60225752 CTTACAGGGTGGGGGAGAAAGGG - Intergenic
931493020 2:62770514-62770536 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
931547267 2:63402784-63402806 CTGGCAAGGTTGTGGAAAAAAGG + Intronic
931757129 2:65384273-65384295 CTGACAGGGTTGGGAGAAAGGGG - Intronic
931927632 2:67091469-67091491 CTGCCAGGGATGTGGAGTAAAGG + Intergenic
934640348 2:96023992-96024014 CTGGCAGGGCTGGGAGAAAAAGG + Exonic
934793304 2:97081424-97081446 CTGGCAGGGCTGGGAGAAAAAGG - Intergenic
935151800 2:100443768-100443790 CTGGCAAGGTTGCGGAGAAAAGG + Intergenic
935594112 2:104866548-104866570 CTGGCTGAGTTGGGGCAAAATGG + Intergenic
936383406 2:112007515-112007537 TTGCCAGGGCTGGGGAGAAAGGG - Intronic
936390633 2:112069806-112069828 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
936984037 2:118291094-118291116 CTGACAGGCCTGGGGATAAATGG + Intergenic
937070434 2:119059332-119059354 CCTCGAGGGTGGGGGAAAAATGG - Intergenic
937376943 2:121343647-121343669 ATGCCAGGGGTTGGGAAAGAAGG + Intronic
938126770 2:128679861-128679883 CTGCCAGGGTTGAGGGATATTGG + Intergenic
939107046 2:137961514-137961536 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
939566947 2:143796344-143796366 CTGGCAGCATTGGGCAAAAAAGG - Intergenic
940366543 2:152854355-152854377 CTGGCAGGGTTGCAGAGAAAAGG - Intergenic
940615736 2:156047104-156047126 CTGGCAAGGCTGAGGAAAAAAGG + Intergenic
941133224 2:161680439-161680461 GTCACAGGGTTGGGGAAAGATGG + Intronic
941839838 2:170069588-170069610 TTGCCAGGGTCTGGGAGAAATGG - Intronic
941980920 2:171455647-171455669 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
942398990 2:175581244-175581266 CTGCCTGGGCTGGGAATAAATGG + Intergenic
942401092 2:175604241-175604263 CTGTCAGGGGTGGGGAGCAAGGG + Intergenic
943322328 2:186460990-186461012 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
943331805 2:186568995-186569017 CTGGCAAGGTTGTGGAGAAATGG + Intergenic
943550673 2:189335740-189335762 CTGCCAGGGTCTGGGGGAAAAGG + Intergenic
944225040 2:197341193-197341215 CTCCCAAGGTTGGGGCAACAAGG + Intergenic
944546173 2:200801206-200801228 CTGGCAAGGTTGCAGAAAAAAGG + Intergenic
945000646 2:205346428-205346450 GTTTCAGGGTTGAGGAAAAAAGG + Intronic
945327462 2:208499206-208499228 CTGTCAGGGTCAGGAAAAAAGGG + Intronic
945347388 2:208733970-208733992 CTGGCAAGGCTGTGGAAAAAAGG - Intronic
946012193 2:216574179-216574201 CCTCCAGGGGTGGGGAAAGAGGG + Intronic
946338107 2:219051681-219051703 GTGCCTGAGTTGGGGAAAAGAGG - Intergenic
946466057 2:219913222-219913244 CTCCCAGGGTTGGGGGAACCAGG + Intergenic
947500775 2:230669163-230669185 GTGCCAGGGCTGGGGACACAGGG - Intergenic
947592386 2:231393166-231393188 CAGCCAGGGTTGGGGACAGCAGG + Intergenic
947760494 2:232600320-232600342 CTGCCAGGATGGGGCCAAAAGGG + Intergenic
948428480 2:237902959-237902981 CAGCCTGGATTGGGGTAAAATGG - Intronic
948622017 2:239241326-239241348 CTGCCCAGGTTGGGGTGAAAGGG + Intronic
948686562 2:239674230-239674252 CTGCCAGGCTGCGGGAAAACAGG + Intergenic
948808252 2:240462139-240462161 CTGCCACGGCGGGGGAAACATGG + Intronic
1169188238 20:3638279-3638301 CTGTCAGGGGTGGGGAGCAAGGG - Intronic
1169553363 20:6724261-6724283 CTGTCACGGATTGGGAAAAAAGG + Intergenic
1169579769 20:7007010-7007032 CTGGCAGGGTTGGGGGAAGGTGG + Intergenic
1169801392 20:9515718-9515740 CTGCCGGGGTGTGGGAAAGAAGG - Intronic
1170203671 20:13773652-13773674 TTGACAGGTTTGGGTAAAAATGG - Intronic
1170490554 20:16869338-16869360 CTGGCAGGGATGTGGAGAAAAGG + Intergenic
1170665180 20:18380481-18380503 CTGGCAAGGTTGTGGAAAAAAGG - Intergenic
1172402511 20:34661850-34661872 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1172454980 20:35063415-35063437 CTGCCAGAGCTGGGGAGAAGGGG + Intronic
1172656120 20:36539576-36539598 CTGCCAGGGGCGGGGAGAAGGGG + Intergenic
1173186234 20:40842663-40842685 ATGCCAGGGGTTGGGAAAAGGGG + Intergenic
1173298624 20:41781287-41781309 CAGCCAGGGATGGGCTAAAAGGG + Intergenic
1173554784 20:43958419-43958441 CAGCCAGGTTGGGGGAAAACCGG - Intronic
1173724957 20:45290962-45290984 CTGCCAGAGTCGGGGAATTAAGG + Intergenic
1174289985 20:49501357-49501379 TTTCCAGGGATGGGGAAATAGGG - Intergenic
1174944047 20:54965163-54965185 ATGTCTGGGTTGGGGAAAAATGG - Intergenic
1176284702 21:5013229-5013251 CTTCCAGGGTTGGGGAGGGACGG + Intergenic
1176606707 21:8839910-8839932 GTGCCAAGTTTGTGGAAAAAAGG - Intergenic
1176742424 21:10616615-10616637 CTGCTAGTGTTGGGAAAGAAAGG - Intergenic
1176894240 21:14357238-14357260 CAGCCAGGGTTGGGAAAAGGAGG - Intergenic
1177175016 21:17693850-17693872 CTGCCAGCTTTGGGGAAGACTGG + Intergenic
1178234111 21:30821919-30821941 GGGCCAGGGTTGGGGTAAAGGGG - Intergenic
1178358260 21:31926505-31926527 TTGCCAGGGCTGGGGGAAGAGGG - Intronic
1178415757 21:32403786-32403808 CTGCCAGGGCTGGGGAGAGGTGG + Intergenic
1179011423 21:37559165-37559187 CTGCCAAGGCTGGGTCAAAAAGG - Intergenic
1179872479 21:44250246-44250268 CTTCCAGGGTTGGGGAGGGACGG - Intronic
1180564303 22:16649825-16649847 CTGCTAGTGTTGGGAAAGAAAGG - Intergenic
1180801939 22:18636064-18636086 CTGCTAGGGTGGGGGAAGAGCGG + Intergenic
1181219781 22:21359197-21359219 CTGCTAGGGTGGGGGAAGAGCGG - Intergenic
1181880408 22:25974966-25974988 GTCCCAGAGTTGGAGAAAAATGG + Intronic
1182904123 22:33921312-33921334 CCGCCGGGGTTGGGGGAAGAAGG - Intronic
1183022780 22:35040514-35040536 GGGCCAGGGCTGGGGACAAAGGG - Intergenic
1183921583 22:41173797-41173819 CACCCAGAGTTGGGGAAAAACGG + Intronic
1184042616 22:41952955-41952977 CTGCCAGGGTTGGTGAAGGTAGG - Intergenic
1184178786 22:42805513-42805535 CTGCCAGGGGTGGTCACAAAAGG + Intronic
1184340227 22:43881784-43881806 CTGCCCAGGTTAGGGAAGAAGGG + Intronic
949114672 3:305757-305779 CTGGCAGGGATGGGGAGAAGAGG + Intronic
949663492 3:6309438-6309460 CTGGCAAGGCTGTGGAAAAAAGG + Intergenic
949799021 3:7882981-7883003 CTGTCAAGGTTGTGGAGAAAGGG + Intergenic
949834382 3:8252226-8252248 CTGCCAAGGTTGTGGAGAAAAGG - Intergenic
950165332 3:10792991-10793013 CTGCCACGGTGGGGAAAAAGTGG - Intergenic
950359409 3:12439940-12439962 CTTCCAGTATTGTGGAAAAATGG - Intergenic
950578806 3:13849917-13849939 CAGACAGGGTTGGGGTACAATGG + Intronic
951260973 3:20508049-20508071 CTGGCAAGGTTGTGGAGAAAGGG - Intergenic
952065206 3:29561398-29561420 CTGGCAAGGTTGTGGAAAAAAGG - Intronic
954443454 3:50534210-50534232 CTGCCAGGGCTGGGGACAGGAGG - Intergenic
954464638 3:50647235-50647257 GTGCCAGGATTTGGGCAAAAGGG + Intronic
954486318 3:50855833-50855855 CTGTCAGGGGTGGGGGTAAAGGG - Intronic
954486374 3:50856318-50856340 CTGGCAAGGTTGAGGAGAAAAGG - Intronic
954512808 3:51142402-51142424 TTGCTAGGGCTGGGGAAGAAGGG - Intronic
954578637 3:51691054-51691076 CTACCAGGGTTGGAGAAAGAAGG - Intronic
955442184 3:58968345-58968367 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
955658722 3:61273509-61273531 CTGGCAAGGATGTGGAAAAAAGG - Intergenic
955956198 3:64292794-64292816 CTGCCTGGGTTGGGGCAGAAGGG - Intronic
956216641 3:66856301-66856323 ATGCTAGAGTTGGGGAAGAAGGG + Intergenic
956374752 3:68602653-68602675 CTGGCGAGGTTGGGGAGAAAAGG - Intergenic
956375615 3:68610350-68610372 CTGTCAGGGTTGGGGACAGAGGG + Intergenic
957457002 3:80464554-80464576 CTGGCAAGGCTGTGGAAAAAAGG - Intergenic
957755790 3:84485322-84485344 CTGGCAGGGGTGTAGAAAAAGGG - Intergenic
958663416 3:97102757-97102779 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
958854496 3:99368126-99368148 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
959090416 3:101896735-101896757 TTGCCTGGGGTTGGGAAAAAGGG - Intergenic
959463389 3:106654163-106654185 CTGGCAAGGTTGAGGAGAAAAGG + Intergenic
959510426 3:107204713-107204735 CTGGCAAGGTTGTGGATAAAAGG + Intergenic
959770880 3:110094269-110094291 CTGCCAGGGATTGGGGGAAAGGG - Intergenic
960285241 3:115820922-115820944 CTGCCAGGATTTGGGAAATAAGG - Intronic
960387269 3:117035504-117035526 CTCCCAGGGGATGGGAAAAATGG - Intronic
961467097 3:127088695-127088717 CCGCCAGGGCTCGGGAAGAAGGG - Intergenic
961986619 3:131141345-131141367 CTGCTCAGGATGGGGAAAAATGG + Intronic
962073940 3:132060691-132060713 CTGCTGAGGTTGTGGAAAAAAGG - Intronic
963831166 3:150011136-150011158 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
964057894 3:152484209-152484231 CCCCTAGGGATGGGGAAAAAGGG - Intergenic
964593580 3:158395684-158395706 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
965964497 3:174470133-174470155 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
966152807 3:176883359-176883381 CTGGCAAGGTTGCAGAAAAAAGG + Intergenic
966238680 3:177730457-177730479 CTTTCAAAGTTGGGGAAAAAGGG - Intergenic
966280367 3:178219634-178219656 CTGTCAGGGTTGGGGGCAAGGGG - Intergenic
966617459 3:181927323-181927345 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
967219599 3:187237470-187237492 CATCCAGGGTTGGGGAAAGGTGG + Intronic
967670828 3:192233187-192233209 CTGGTGGGGTTGTGGAAAAAAGG - Intronic
967701719 3:192600804-192600826 CTGGCAGGGATGCAGAAAAAAGG + Intronic
967853296 3:194098109-194098131 CTCCCTGGGTTGGGGAGAAGAGG + Intergenic
968019285 3:195369896-195369918 CTGCCAAGGTTGTGGAGAAAAGG - Intronic
968129839 3:196186608-196186630 GGACCAGGCTTGGGGAAAAAAGG + Intergenic
969163431 4:5281435-5281457 CTGTTAGGGTTGGGGGCAAAGGG + Intronic
969631223 4:8338722-8338744 CTGTCAAGGATGGGGAGAAAGGG - Intergenic
969860582 4:10032529-10032551 CTGTCAGGGTTGGGGAGAATGGG + Intronic
970371859 4:15416053-15416075 GTGAAAGTGTTGGGGAAAAAGGG + Intronic
970500708 4:16673813-16673835 ATGCCAGGGTTGGGAAAGCATGG + Intronic
970570798 4:17380404-17380426 CTGGCAGGGCTGTGGAGAAATGG - Intergenic
970624667 4:17863501-17863523 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
971571135 4:28212485-28212507 GTGGAAGGGTTGGGGAAAATAGG - Intergenic
971710929 4:30111631-30111653 CTGCCAAGAGTGTGGAAAAATGG + Intergenic
971797726 4:31250368-31250390 CTGACAAGGATGTGGAAAAAGGG + Intergenic
973295957 4:48521034-48521056 CTGCCTGAGGTGGGGAGAAATGG - Exonic
973611934 4:52644263-52644285 GAGCCAGGGTTGTGGAATAATGG - Intronic
973709926 4:53619357-53619379 TTGCCAGGGCTGGGAAAAGAAGG - Intronic
973957037 4:56072752-56072774 CTGTCTGGGGTGGGGAAACAAGG - Intergenic
974063827 4:57059102-57059124 CTGGCAAGGTTGCGGAGAAAAGG + Intronic
974364699 4:60931197-60931219 GTGCCAAGGTTGGAGAGAAAAGG + Intergenic
974535132 4:63164681-63164703 CTGGCAAGGTTGTGGCAAAAAGG - Intergenic
976197912 4:82551057-82551079 CTGCAAGAGTTGGGGGAGAAAGG + Intronic
977091131 4:92677099-92677121 CTGCCAGGGGTTGGGAAGAGAGG + Intronic
977102135 4:92829926-92829948 CTGTCAGGGGTGGGGACAAGGGG + Intronic
977170432 4:93754802-93754824 ATGCAAGGGTTGGGGTAAAGTGG + Intronic
978019788 4:103793245-103793267 CTGTCAGGGTTGGGGGACTAGGG + Intergenic
978059066 4:104313536-104313558 CTGTCAGGGATGTGGAGAAAAGG + Intergenic
978112840 4:104983859-104983881 CTGACAGGGTTGTGGAGAAAAGG + Intergenic
979758265 4:124368606-124368628 CTGGCAAGGCTGTGGAAAAATGG - Intergenic
980197719 4:129613090-129613112 CTGGCAAGGTTGTGGATAAAAGG + Intergenic
980206300 4:129723087-129723109 CTGTCAAGGTTGTGGAGAAAAGG + Intergenic
980454407 4:133020456-133020478 CTGTCAGGGTTGGGGGGCAAGGG + Intergenic
980548668 4:134304000-134304022 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
980647513 4:135661722-135661744 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
981564544 4:146085349-146085371 CTGGCAAGGATGTGGAAAAAAGG + Intergenic
982029937 4:151290527-151290549 CTGGGAGGGTTGGGAAGAAATGG + Intronic
982212374 4:153048829-153048851 TTGGCAGGGCTGTGGAAAAAAGG - Intergenic
982943766 4:161592077-161592099 CTACCAGGTTTGAAGAAAAAAGG + Intronic
982956905 4:161781644-161781666 CTGCATGTGTTGGGGAAAAAGGG - Intronic
983016733 4:162622622-162622644 CTGGCAGGGCTTGGGAAAAAAGG - Intergenic
983271450 4:165567186-165567208 CTGCCAATGTTGGGCATAAAGGG - Intergenic
983595324 4:169459861-169459883 TTGCCAGGGTTTGGAAGAAAGGG + Intronic
984672802 4:182511071-182511093 CTGCCAGAGTTGGGGAACAAAGG + Intronic
984936767 4:184896893-184896915 CTGCAGGGGTTGGGGGAAAGGGG + Intergenic
985156352 4:186991966-186991988 CTGCCAAGGTTGTGGAGAAAAGG + Intergenic
986028413 5:3872302-3872324 ATGCCAGGGATGGGGGAAGATGG + Intergenic
986285663 5:6356442-6356464 CTGACATGGTAAGGGAAAAAGGG + Intergenic
986297985 5:6455527-6455549 CTGCCAGGGTTGGGAACCACTGG - Intronic
987197087 5:15537521-15537543 CTGCAGGGGATGGGGAAGAACGG - Intronic
988324405 5:29743293-29743315 CTGACAAGGTTGTGGAGAAAAGG + Intergenic
988494056 5:31729572-31729594 CTTCCAGGGTAGTAGAAAAAAGG - Intronic
988885095 5:35547919-35547941 TTATCAGGGTTGGGGAAAAAGGG + Intergenic
988960938 5:36370906-36370928 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
989403261 5:41032211-41032233 CTGCTAAGGTTGTGGAGAAAAGG - Intronic
989509156 5:42263990-42264012 CTGTCAGGGTTGGGGAGCTAGGG - Intergenic
990196091 5:53318142-53318164 CTGCCAGTGTAGGGGTAAAAAGG + Intergenic
990291081 5:54352624-54352646 CTGACAGGGTTGTGGAGAAAAGG - Intergenic
990348668 5:54893938-54893960 CTGGCAAGGTTGAGGAGAAAAGG + Intergenic
991017060 5:61943712-61943734 CTCCCAGGCTTGGTCAAAAATGG - Intergenic
991581314 5:68157909-68157931 CTGTCAGGGGTGGGGGGAAAGGG + Intergenic
992056261 5:72994487-72994509 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
993139075 5:84007633-84007655 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
993146764 5:84103724-84103746 CTGGCAAGGTTGAGGAGAAAAGG + Intronic
993213926 5:84994358-84994380 CTGGCAAGGTTGTGGAAAAAAGG - Intergenic
993242669 5:85410983-85411005 CTGGCAAGGTTGTGGACAAAAGG - Intergenic
993742576 5:91559036-91559058 CTGCCAGGCTTTGGTAAAACAGG - Intergenic
993900197 5:93579731-93579753 CTCCCAGGGGTGGGGACAGAGGG - Intergenic
994228450 5:97283254-97283276 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
994470692 5:100201141-100201163 CTGGCAAGGTTGTGGATAAAAGG - Intergenic
994573166 5:101539532-101539554 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
994619766 5:102149296-102149318 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
994630088 5:102274555-102274577 CTGCCAGGGGTAGGGCAGAATGG + Intronic
994706593 5:103214573-103214595 CTGGCAGGGTTGCAGAGAAAAGG + Intergenic
994836104 5:104854857-104854879 CTGGCAAGGTTGCGGAGAAAAGG - Intergenic
995002987 5:107158001-107158023 CTGCCTGGGTGGGGGAAGGAAGG + Intergenic
995211560 5:109545363-109545385 CTGGCGAGGTTGTGGAAAAAAGG - Intergenic
995839904 5:116434015-116434037 CTGACAGGGTAGGGGAAGTAGGG - Intergenic
996166664 5:120232048-120232070 CTGACAAGGTTGTGGAGAAAAGG - Intergenic
996305670 5:122044484-122044506 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
996631369 5:125636936-125636958 CTGGCAAGGTTGTGGACAAAAGG - Intergenic
996784304 5:127222075-127222097 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
996829345 5:127722098-127722120 CTGGCAGGGATGTGGAGAAAAGG - Intergenic
996902559 5:128559422-128559444 CTGCCGAGGTTGTGGAGAAAAGG + Intronic
997035234 5:130182884-130182906 CTGGCAGGGCTAAGGAAAAAAGG - Intronic
997457426 5:134027503-134027525 GTGCCAGGGTGGGACAAAAAAGG + Intergenic
997769251 5:136539124-136539146 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
997790866 5:136760704-136760726 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
998568838 5:143239244-143239266 CTGCTAGGGTTGGGAAAAACAGG + Intergenic
999412662 5:151365966-151365988 CAGCCTGGTTTGGAGAAAAAGGG + Intergenic
1000639765 5:163687816-163687838 CTGCCAGGCTGCGGGAAAGATGG + Intergenic
1001103609 5:168834339-168834361 CTCCCAGGTTTGGATAAAAATGG + Intronic
1001393760 5:171402361-171402383 CTGGCAAGGTTGCAGAAAAAAGG + Intronic
1002369024 5:178735194-178735216 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1002434487 5:179222383-179222405 CTGCCCCGGTTGGGGAGGAAAGG - Intronic
1002461510 5:179376047-179376069 CAGCCAGAGGAGGGGAAAAAGGG + Intergenic
1003032517 6:2614656-2614678 CTGGCAAGGTTGTGGAGAAATGG - Intergenic
1003074008 6:2967801-2967823 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003421602 6:5963409-5963431 CTGCAAGGATTGGGGCAACATGG - Intergenic
1003459443 6:6316964-6316986 TTGCCAGGATTGGGAAAAACGGG - Intronic
1004380538 6:15128627-15128649 ATGGCTGGTTTGGGGAAAAAGGG - Intergenic
1004874965 6:19942002-19942024 GTGCCAGAGTTGGGGAAGATAGG + Intergenic
1004901267 6:20196424-20196446 TTGCCAGGATTGAGGAAGAAGGG + Intronic
1006510260 6:34517550-34517572 CTGCCAGGCTTGAGGAGCAAGGG - Intronic
1006582250 6:35083843-35083865 CTTCCAGGGTGGGGGCAAAGTGG - Intronic
1008354258 6:50532921-50532943 CTGCTAGGGATGGGGTAACATGG - Intergenic
1008642521 6:53479150-53479172 CTGCCAAGGTTGTGGAGAAAAGG - Intergenic
1009035023 6:58106590-58106612 CCTCCAGGCTTGGAGAAAAAAGG + Intergenic
1009210534 6:60857307-60857329 CCTCCAGGCTTGGAGAAAAAAGG + Intergenic
1009273437 6:61644814-61644836 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1010023237 6:71186014-71186036 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1010089284 6:71961039-71961061 GTGCCAGAGGTGGGGAAGAAGGG - Intronic
1010272624 6:73931405-73931427 TTGGCAAGGTTGTGGAAAAAAGG - Intergenic
1010342510 6:74771486-74771508 TTGACAGGGGTGGGGGAAAAGGG - Intergenic
1010596641 6:77771295-77771317 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1010761136 6:79724605-79724627 GAGCAAGGGGTGGGGAAAAAAGG - Intergenic
1012963073 6:105643592-105643614 CTTGCAGGGCTGGGGAACAAAGG + Intergenic
1013185917 6:107757920-107757942 CTGCGAGGTGTGAGGAAAAAGGG - Intronic
1013244159 6:108270982-108271004 CTGGCAAGGCTGTGGAAAAAAGG + Intergenic
1013499301 6:110732045-110732067 ATGGGAGGGTTGGGTAAAAATGG - Intronic
1014367604 6:120563488-120563510 CTCCAAGGGTGGGGGAAGAATGG - Intergenic
1014372743 6:120632750-120632772 CTGGCAAAGTTGGGGAAAAAAGG + Intergenic
1014958133 6:127647703-127647725 CTGGCAAGGATGTGGAAAAAAGG + Intergenic
1015247001 6:131086120-131086142 CTGAAAGAGATGGGGAAAAATGG + Intergenic
1015325651 6:131920382-131920404 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1016238052 6:141891709-141891731 CTACCAAGGTTGTGGAAAAAAGG + Intergenic
1016287840 6:142493172-142493194 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1016571366 6:145516739-145516761 CTGCCAGGAGTGGGTATAAAAGG + Intronic
1016988888 6:149916081-149916103 GTGCCAGGGTTGGGGCTCAAGGG - Intergenic
1017082308 6:150681647-150681669 CTCCAGGGGATGGGGAAAAAAGG - Intronic
1018317417 6:162570313-162570335 CTGTCAAGGTTGTGGAGAAAAGG + Intronic
1018493871 6:164327534-164327556 CTTCCAGGGTTGGGGTGGAAAGG - Intergenic
1018671672 6:166183024-166183046 CTGACAAGGTTGCGGAGAAAAGG - Intergenic
1019172031 6:170138079-170138101 CTGCCAGGGTTGGGACTTAAGGG + Intergenic
1020518819 7:9160361-9160383 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1021124293 7:16832827-16832849 CTGGCAGGGATGTGGAGAAAAGG + Intronic
1021137405 7:16982304-16982326 TTGGCAAGGTTGGGGAGAAAAGG - Intergenic
1022470117 7:30676894-30676916 CTGCCAGGACAGGGGAAGAAGGG - Intronic
1022831376 7:34070521-34070543 CTGACAGGGGTGTGCAAAAAGGG - Intronic
1023098522 7:36688751-36688773 GTGCCTGGGTTGGAGAATAAAGG + Intronic
1023782820 7:43673500-43673522 CTGGCAAGGTTGCGGAGAAAAGG + Intronic
1024009787 7:45257818-45257840 CTGTCGGGGTTGGGGGACAAGGG + Intergenic
1024217688 7:47261736-47261758 CTGGCCAGGTTGGGGAGAAAAGG + Intergenic
1024845168 7:53634054-53634076 CTGGCAAGGTTGTGGAGAAATGG + Intergenic
1024848359 7:53678099-53678121 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1026209541 7:68291617-68291639 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1026513289 7:71045289-71045311 TTGGCAGGGTTGCGGAGAAAGGG + Intergenic
1026861899 7:73796016-73796038 TTGGCAAGGTTGGGGAGAAAAGG - Intergenic
1027538421 7:79436703-79436725 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1028329369 7:89569954-89569976 CTGCCCAGGTTGTGGAGAAAAGG + Intergenic
1028521508 7:91736279-91736301 CTGCCAAGGATGTGGAGAAAAGG - Intronic
1028595361 7:92542857-92542879 CTGCCAGGGATGTGAAGAAAAGG + Intergenic
1029088478 7:98030055-98030077 CTGGCAAGGTTGTGGAAAAGGGG - Intergenic
1029536678 7:101161344-101161366 CTGCCAGCCTTGGGAAGAAACGG + Intronic
1029645100 7:101849816-101849838 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1030220413 7:107092883-107092905 CTGCCAGGGCTGGGAACAGAAGG - Intronic
1030665958 7:112278904-112278926 TTGCCAGGGCTGGGGAAAGTGGG - Intronic
1031542657 7:123013816-123013838 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1032155648 7:129465451-129465473 CTGCCTGGGGCGGGGAAAGATGG + Intronic
1032660775 7:133981607-133981629 CTGGTAAGGTTGTGGAAAAAAGG + Intronic
1033270206 7:139924286-139924308 CTGCCAAGGATGTGGAGAAAAGG - Intronic
1036398066 8:8385808-8385830 CAGCCAGGGCTCGGGGAAAAGGG + Intronic
1036772821 8:11590823-11590845 ATGCCAGGGCTGGGAGAAAAGGG + Intergenic
1036961384 8:13248539-13248561 CTGCCAAGGTTGGAGTTAAAGGG - Intronic
1037578039 8:20226345-20226367 CTGGTAGGGTTGGGGAGAAATGG - Intronic
1037940547 8:22947865-22947887 CTGCCCAGGGTGGGGAGAAATGG + Intronic
1037995935 8:23352416-23352438 CTGGGTGGTTTGGGGAAAAAAGG - Intronic
1038352385 8:26789098-26789120 CTGTCAGGGGTGGGGGGAAAAGG - Intronic
1038488789 8:27954884-27954906 CTGCCAGAGCTTTGGAAAAATGG - Intronic
1039282341 8:35999242-35999264 CTGACAAGGTTGTGGAGAAAAGG - Intergenic
1039331751 8:36544933-36544955 CTGGCAGGGATGTGGAGAAAGGG + Intergenic
1039335513 8:36584856-36584878 CTGGCAAGGCTGAGGAAAAAAGG - Intergenic
1039708224 8:40029145-40029167 CTGGCAAGGATGTGGAAAAAAGG - Intergenic
1040057696 8:43074742-43074764 TTGCCAGGGTGAGGGAAAAGGGG + Intronic
1040377920 8:46844386-46844408 CAGACAGGGTTGAAGAAAAAGGG - Intergenic
1040380103 8:46864312-46864334 CAGACAGGGTTGAAGAAAAAGGG - Intergenic
1040413670 8:47179670-47179692 CTGCCGGGGGTGGAGAAAAGTGG + Intergenic
1041523287 8:58777922-58777944 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1041711085 8:60895184-60895206 CTGTGTGGGTTGGTGAAAAAAGG - Intergenic
1042898891 8:73701587-73701609 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1043185926 8:77149705-77149727 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1043835963 8:85046281-85046303 CTGGCAAGGTTGCAGAAAAAAGG - Intergenic
1043942174 8:86208267-86208289 CTGACAGGGCTGTGGAGAAAAGG + Intergenic
1044040731 8:87365127-87365149 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1044192562 8:89336235-89336257 CTGACAGGGATGTGGAGAAAAGG - Intergenic
1044769214 8:95611816-95611838 CTGGCAAGGTTGAGGAGAAAAGG - Intergenic
1044959954 8:97520821-97520843 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1045074502 8:98548721-98548743 TTGCCAGGGCTGGGGAAAGGGGG - Intronic
1045344036 8:101278741-101278763 CTGGCAGGGCTGTGGAGAAAAGG + Intergenic
1045432906 8:102129961-102129983 CTGGCAAGGATGGGGAGAAAAGG + Intergenic
1045619503 8:103957909-103957931 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1046709459 8:117493526-117493548 CTGGCAAGGTTGAGGACAAAAGG - Intergenic
1046746015 8:117876930-117876952 CTACCAGGCTGTGGGAAAAAAGG + Intronic
1046949538 8:120006550-120006572 GTGCCAGGGGTGGGGATAAGGGG - Intronic
1047059634 8:121210221-121210243 CTACCTGGGTAGGAGAAAAAAGG - Intergenic
1047826364 8:128580718-128580740 CTGCCAGGCTTGGGTAAAGAGGG + Intergenic
1048079758 8:131112772-131112794 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1048701611 8:137097393-137097415 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1049104266 8:140601570-140601592 CTGCCATGGTTGCGGAGCAAAGG - Intronic
1050189755 9:3012442-3012464 CTGCCAGGGTTGAGGGAGGAAGG - Intergenic
1050245523 9:3685710-3685732 CTGCCTGATTTGGGGAATAAAGG + Intergenic
1050304627 9:4295961-4295983 CTATCAGGACTGGGGAAAAAAGG - Intronic
1050349832 9:4730167-4730189 CTGGGAGGGTTGGGGAGAAATGG + Intronic
1050425737 9:5510862-5510884 CTGCCAGGGTGGGGGAAGGGTGG + Intronic
1050755275 9:8994921-8994943 CTGCAACATTTGGGGAAAAATGG + Intronic
1050776640 9:9270991-9271013 CTTTGAGGGTTGGGGATAAAGGG + Intronic
1050928109 9:11291365-11291387 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1052065456 9:24013290-24013312 TTGCCAAGAGTGGGGAAAAAGGG - Intergenic
1052380720 9:27767856-27767878 CTGTCGGGGTTGGGGGAAAGGGG + Intergenic
1052915226 9:33920005-33920027 TTGCCAGGGTAAGGGAAAGAAGG - Exonic
1052957901 9:34269109-34269131 ATGCCAGGGTTGGAGATAGAGGG - Intronic
1053592828 9:39531691-39531713 CTGTCATGGTTGGGGGAAAGGGG + Intergenic
1054573475 9:66833588-66833610 CTGTCATGGTTGGGGGAAAGGGG - Intergenic
1054863623 9:69977788-69977810 CTTCCCAGGTTGGAGAAAAATGG + Intergenic
1055201890 9:73673873-73673895 CTGGCAGGGCTGTGGAGAAAAGG + Intergenic
1055803340 9:80065463-80065485 CTGCCAGAAGGGGGGAAAAAAGG + Intergenic
1056085366 9:83143663-83143685 CTGGCAAGGCTGTGGAAAAAAGG + Intergenic
1056959457 9:91109872-91109894 CTGGCAAGGTTGTAGAAAAAAGG + Intergenic
1057512000 9:95688183-95688205 CGGGCAAGGTTGGGGAGAAAAGG + Intergenic
1058077907 9:100669068-100669090 CTGGCAAGGATGTGGAAAAAAGG + Intergenic
1058199604 9:102022856-102022878 CTGGCAGGGTTGTGGAGAAAAGG - Intergenic
1058240636 9:102553389-102553411 TTGACAGGGTTGTGGAGAAAAGG - Intergenic
1058317756 9:103589482-103589504 CTGGCAAGGATGTGGAAAAAAGG + Intergenic
1058534577 9:105945008-105945030 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1059237392 9:112772540-112772562 CTGCCATGGTTTGAGCAAAATGG + Intronic
1059512003 9:114857193-114857215 CTGGCAAGGTTGCGGAGAAAAGG + Intergenic
1059578188 9:115514563-115514585 GTGCCAGGGTTGGGGAACAAAGG + Intergenic
1060220345 9:121761143-121761165 CTACCCGGTTTGGGGACAAATGG + Intronic
1060455987 9:123798117-123798139 ATGCCAGTGTTGGGGGAAAATGG - Intronic
1060531942 9:124352821-124352843 CTGGCAGTGTTGGGGAGACACGG - Exonic
1060534564 9:124374222-124374244 CTGGGAAGGTTGGGGGAAAATGG + Intronic
1060687980 9:125629596-125629618 CTGCCAGGGCTGGGGGCAAGAGG + Intronic
1060946738 9:127574180-127574202 ATGCCAGGGCTGTGGACAAAGGG + Intronic
1061169462 9:128943850-128943872 CTCCCAAGCTTGGGGAGAAAGGG + Intronic
1061620431 9:131808029-131808051 CTGGGAGGGTTGGGAAAAGATGG - Intergenic
1062205016 9:135331468-135331490 CTGCCAGGGTGTGGCAGAAATGG + Intergenic
1062471405 9:136707146-136707168 CTGCCAGTGGTGTGGCAAAAAGG - Intergenic
1185891605 X:3827180-3827202 CTGCCAGGGTTGGGGAAAAAGGG + Intronic
1185896716 X:3865595-3865617 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1185901834 X:3904022-3904044 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1185915554 X:4030714-4030736 GTGCCAGGGTTGGAGGAAGAGGG - Intergenic
1186082404 X:5947318-5947340 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1187288814 X:17932310-17932332 CTGCCCGGGTGGGAGAAACAGGG - Intergenic
1187295205 X:17992666-17992688 CTGCCAGGGCTGGGGATACGGGG + Intergenic
1188014332 X:25091224-25091246 CTGGCAAGGTTGAGGAGAAAAGG - Intergenic
1188134398 X:26476834-26476856 CTGGCAAGGTTGCGGAGAAAAGG + Intergenic
1188413577 X:29904519-29904541 CTGTCGGGGTTGGGGGCAAAGGG - Intronic
1188985762 X:36767140-36767162 CAGCCAGGCTAGGGGAGAAAAGG - Intergenic
1189134523 X:38534536-38534558 TGGCCAGGGTTGGGGAAGGAAGG - Intronic
1189766380 X:44376690-44376712 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1190031603 X:46978450-46978472 GAACCAGGGTTGGGGAAAATGGG + Intronic
1190478720 X:50853196-50853218 CTACCAGAGTTGAGCAAAAACGG + Intergenic
1190507473 X:51140555-51140577 TTGGAAGGGTAGGGGAAAAAGGG - Intergenic
1190511070 X:51174981-51175003 CTGCCAGGGGTGGGGGGCAAGGG + Intergenic
1190515273 X:51217309-51217331 CTGCCATGGTTGTGGAGAAAAGG - Intergenic
1190910917 X:54771854-54771876 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1190961123 X:55249181-55249203 CTGACAGGGATGTGGAGAAAAGG + Intronic
1191001459 X:55663737-55663759 CAGACAGGGTTGAGGAATAATGG + Intergenic
1191730338 X:64327534-64327556 CTGACAAGGATGTGGAAAAAGGG + Intronic
1191865261 X:65698609-65698631 CTGCCTGGGGTGGGGAAAAGAGG + Intronic
1191885879 X:65887515-65887537 CCTCCAGTCTTGGGGAAAAAAGG - Intergenic
1192098933 X:68243208-68243230 TTACCAGGGCTGGGGAAAATGGG + Intronic
1192115968 X:68411403-68411425 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1192288885 X:69770370-69770392 CTGGCAGGGCTGTGGAAAAAGGG - Intronic
1192596817 X:72418540-72418562 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1192655613 X:72990466-72990488 CTGGCAAGGCTGGGGAGAAAAGG + Intergenic
1192664450 X:73073598-73073620 GTGGCAGGGTTGGGGGAAATGGG - Intergenic
1192837783 X:74820362-74820384 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1192936492 X:75863882-75863904 CTGGCAAGGTTGGGGTAAAAGGG - Intergenic
1193310876 X:80009100-80009122 CTGGCAAGGTTGTGGAAAGAAGG - Intergenic
1193484483 X:82069869-82069891 CTGGCAAGGTTGTGGGAAAAAGG - Intergenic
1193492920 X:82171440-82171462 CTGGCAAGGTTGCGGAGAAAGGG + Intergenic
1193523758 X:82563365-82563387 CTGCTAAGGTTGTGGAGAAAAGG + Intergenic
1193826471 X:86232698-86232720 CTGGCAAGGTTGAGGAGAAAAGG + Intronic
1193868000 X:86761191-86761213 CTGTCAGGGATGGGGGGAAAGGG - Intronic
1194290062 X:92060963-92060985 CTGGCAAGGTTGTGGAGAAAAGG - Intronic
1194588272 X:95764891-95764913 CTGCCACAGTGGGGGAAAAAAGG + Intergenic
1194867894 X:99091340-99091362 CTGTCAAGGTTGAGGAGAAAAGG + Intergenic
1195050923 X:101096220-101096242 GTGCCAGGGATGGGGAAATGGGG + Exonic
1195355389 X:104034740-104034762 CTGTCAGGGCTGGGGGACAAGGG - Intergenic
1195534718 X:105998280-105998302 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1195629325 X:107037897-107037919 CTGACAAGGTTGTGGAGAAAAGG + Intergenic
1196333216 X:114497111-114497133 CTGGCAGGGATGTGGAGAAAGGG + Intergenic
1196487367 X:116228375-116228397 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1196487803 X:116233794-116233816 CTGGCAAGGTTGTGGAGAAAAGG - Intergenic
1196771288 X:119296851-119296873 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1196949349 X:120861195-120861217 CTGACAAGGTTGGGGAGAAAAGG - Intergenic
1196983895 X:121246637-121246659 TTGTCAGGGTGGTGGAAAAAGGG + Intergenic
1197279296 X:124516663-124516685 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1197449317 X:126592472-126592494 CTGTCAGGGGTGGGGGGAAAGGG - Intergenic
1197508770 X:127344375-127344397 CTGGCAGGGATGTGGAGAAAAGG + Intergenic
1197970096 X:132106380-132106402 CTGGCAAGGTTGTGGAGAAAAGG + Intronic
1198616253 X:138462092-138462114 TTGCCAGGGTTTGGGAGAAAGGG + Intergenic
1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG + Intronic
1198843359 X:140882423-140882445 CTGGCAAGGTTGCGGAGAAAAGG + Intergenic
1199330112 X:146549479-146549501 CTGCCAAGGTTGTAGAGAAAAGG - Intergenic
1199377332 X:147129043-147129065 CTGGCAGGATTGTGGAGAAAAGG - Intergenic
1199492793 X:148419586-148419608 CTGGCAAGGTTGTGGAGAAAAGG + Intergenic
1200100499 X:153687548-153687570 CTGCCAGGAGCGGGGAGAAAGGG + Intronic
1200328956 X:155274078-155274100 CTGGCAAGGCTGTGGAAAAAAGG + Intergenic
1200521875 Y:4219203-4219225 CTGGCCGGGCTGTGGAAAAATGG + Intergenic
1201264073 Y:12189095-12189117 GTGCAAGGGCTGGGGAAAGAGGG - Intergenic
1202300632 Y:23409853-23409875 CTGGCAAGGTTGCAGAAAAAAGG - Intergenic
1202570179 Y:26260745-26260767 CTGGCAAGGTTGCAGAAAAAAGG + Intergenic