ID: 1185903019

View in Genome Browser
Species Human (GRCh38)
Location X:3912435-3912457
Sequence GGCCGCCGCATCCGCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 3, 1: 0, 2: 4, 3: 49, 4: 333}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185903007_1185903019 23 Left 1185903007 X:3912389-3912411 CCCAGCGGGGCCACACGTGCAAC 0: 3
1: 2
2: 0
3: 4
4: 51
Right 1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG 0: 3
1: 0
2: 4
3: 49
4: 333
1185903013_1185903019 -4 Left 1185903013 X:3912416-3912438 CCCTGGCCCGGAGAAGCCTGGCC 0: 3
1: 0
2: 2
3: 28
4: 258
Right 1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG 0: 3
1: 0
2: 4
3: 49
4: 333
1185903015_1185903019 -10 Left 1185903015 X:3912422-3912444 CCCGGAGAAGCCTGGCCGCCGCA 0: 3
1: 0
2: 1
3: 12
4: 144
Right 1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG 0: 3
1: 0
2: 4
3: 49
4: 333
1185903009_1185903019 13 Left 1185903009 X:3912399-3912421 CCACACGTGCAACGCTGCCCTGG 0: 3
1: 0
2: 1
3: 3
4: 102
Right 1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG 0: 3
1: 0
2: 4
3: 49
4: 333
1185903008_1185903019 22 Left 1185903008 X:3912390-3912412 CCAGCGGGGCCACACGTGCAACG 0: 3
1: 1
2: 1
3: 5
4: 42
Right 1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG 0: 3
1: 0
2: 4
3: 49
4: 333
1185903014_1185903019 -5 Left 1185903014 X:3912417-3912439 CCTGGCCCGGAGAAGCCTGGCCG 0: 3
1: 0
2: 0
3: 18
4: 220
Right 1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG 0: 3
1: 0
2: 4
3: 49
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185903019 Original CRISPR GGCCGCCGCATCCGCCGCGG CGG Intergenic
900651690 1:3732962-3732984 GGCCGCCGCCTGGGCCGCCGCGG - Exonic
901065465 1:6492126-6492148 GGCCGCCTCCCCCGCTGCGGTGG - Intronic
901235248 1:7664196-7664218 GGCTGCCACAGCCGCCGCGGAGG - Exonic
903115698 1:21176770-21176792 GGGCGCCGCTTCCTCCGGGGAGG - Exonic
903205994 1:21782989-21783011 GACCGCCGCAGCCGCCGCCGCGG + Exonic
903652326 1:24929787-24929809 TGCCGCCGCCGCCGCCGCAGGGG + Exonic
904485939 1:30824608-30824630 GGCCGGCGCCCCCGCCGGGGCGG + Intergenic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904782940 1:32964410-32964432 GGCCTCCGCCTCGGCCTCGGCGG + Exonic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
908129136 1:61057288-61057310 AGCCGCCGCAGCCGCCGCAGTGG - Intronic
908355924 1:63324446-63324468 GGCGGCCGCAGCAGCGGCGGCGG - Exonic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
914428602 1:147600196-147600218 CGCCGCCGCTGCCGCCGCCGGGG + Intronic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
917345182 1:174022158-174022180 GGCAGCCGCCGCCGCCGCCGAGG + Exonic
919712095 1:200738936-200738958 AGCCGCCGCCGCCGCCGCTGCGG - Intergenic
920312389 1:205056387-205056409 GCCCGCCGCCTCCGCCTCTGAGG + Intronic
921155069 1:212432959-212432981 AGCGGCCGCAGCCGCCGCCGCGG - Exonic
922753736 1:228082871-228082893 TGTCGCCGCCGCCGCCGCGGGGG - Intronic
922758358 1:228109153-228109175 GGCCGCCACAGTCGCTGCGGAGG + Exonic
923042915 1:230332756-230332778 GGACGCCACATCCACCGCAGCGG + Intronic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064645374 10:17454334-17454356 CGCCGCCGCCACCGCCGCCGTGG + Intergenic
1065023082 10:21516865-21516887 GGCGGCGGCGGCCGCCGCGGGGG - Exonic
1066022772 10:31319582-31319604 CGCCGCCGCATCCCCGGCGCAGG + Intronic
1066429312 10:35336792-35336814 GGCCGGCCTATCCGCGGCGGAGG - Intronic
1066429345 10:35336888-35336910 GGCCGCCGGGTCAGCAGCGGCGG - Exonic
1066464868 10:35642230-35642252 AGCCGCCGCCTCCTCCTCGGCGG + Exonic
1070290667 10:75111520-75111542 GGCCGCCGTCACCGCCGCGCCGG - Intronic
1070570643 10:77637740-77637762 TGCCGCCGCCGCCGCCGCCGCGG + Intronic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1071086873 10:81875388-81875410 AGCCGCCGCCTCGGCCGAGGAGG + Exonic
1072719501 10:97771932-97771954 AGCCGCCGCCGCCGCCGCCGCGG + Exonic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072915528 10:99535462-99535484 GGCCGCCGCTGCTGCGGCGGCGG - Exonic
1074065360 10:110008212-110008234 AGCCGCCGGATCCGCCGCTGCGG - Exonic
1076373074 10:129967284-129967306 CGCCGCCGCCTCCTCCTCGGAGG + Intergenic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1077124364 11:925925-925947 GGTCGCCGTCACCGCCGCGGAGG - Exonic
1077213336 11:1383431-1383453 GGCCGCGGCCTCCGCTGCTGCGG - Intergenic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1081773925 11:45665270-45665292 GGCGGCGGCAGCAGCCGCGGCGG + Exonic
1083813230 11:65117126-65117148 GGCCGCGGGCTCCGCGGCGGAGG + Exonic
1083970307 11:66070406-66070428 CCCCGCCGCCGCCGCCGCGGGGG + Intronic
1084014694 11:66371594-66371616 CCCAGGCGCATCCGCCGCGGCGG - Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1090788549 11:130070271-130070293 GGCTGCCTCAGCCGCCGCAGAGG + Intronic
1091404957 12:203490-203512 GGCCCGGGCGTCCGCCGCGGGGG + Intronic
1091582173 12:1796779-1796801 GGCCGCCGCATTCCCAGCGTGGG + Intronic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1092518439 12:9240414-9240436 CGCAGCCGCCTCCGCCGCCGCGG - Intergenic
1094041121 12:26122641-26122663 CGCCGCCGCTGCCGCCGCCGCGG + Exonic
1094218594 12:27970600-27970622 GGCTCCCGGATCCGCCGCGCCGG - Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1096098956 12:48957338-48957360 GGCCGCCGCCTCTGCCCCGCAGG + Exonic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097170710 12:57111095-57111117 GGCCCCCGCACCCACCTCGGAGG + Intronic
1100315623 12:93441988-93442010 CGTCGCCGCAGCCGCCGCCGAGG + Exonic
1100391308 12:94148356-94148378 GGCGGCCGCGGCGGCCGCGGCGG + Intergenic
1100823893 12:98457045-98457067 AGCAGCAGCAGCCGCCGCGGCGG + Intergenic
1101253831 12:102958358-102958380 GGCGGCCGCAGCCGCCGCAGCGG + Exonic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1103521249 12:121537912-121537934 AGCCGCCGCCGCCGCCGCCGAGG - Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103779525 12:123389451-123389473 CGCCGCCGCCTCCACCGCGCGGG - Exonic
1103954256 12:124567597-124567619 CGCCGCCGCCACCGCCGCCGCGG - Intergenic
1105217511 13:18297711-18297733 CGCCGCCGCCTCCACCGCGCAGG - Intergenic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1107467833 13:40665900-40665922 GGCCGCCGCGGCCGCCACCGGGG - Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107605097 13:42048824-42048846 GGCCGCCGGAGCCGGCGCCGCGG + Exonic
1107851786 13:44577904-44577926 GGCAGCGGCAGCAGCCGCGGCGG - Intergenic
1110705857 13:78601933-78601955 GGCAGCGGCATCGGCGGCGGCGG - Exonic
1111951318 13:94711551-94711573 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1112050618 13:95641766-95641788 GGAGGCCGCACCCGCGGCGGCGG + Exonic
1112507198 13:99982135-99982157 AGCCGCCGCCGCCGCCGCGGCGG - Exonic
1112507199 13:99982138-99982160 GGCAGCCGCCGCCGCCGCCGCGG - Exonic
1113378632 13:109784820-109784842 GGCCGCCGCAGCCGCCGCTCAGG + Exonic
1113656099 13:112068501-112068523 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1115399317 14:32939415-32939437 CGCCGCCGCCTCCGCCGCCGAGG + Intronic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1119743210 14:77027297-77027319 CGCCGCCGCCGCCGCTGCGGTGG - Exonic
1119743212 14:77027300-77027322 CGCCGCCGCCGCCGCCGCTGCGG - Exonic
1122221035 14:100239211-100239233 GGCCGCCGCGGCCGTGGCGGCGG + Exonic
1122254678 14:100468108-100468130 GGCCGGCGCATCCTCAGTGGTGG + Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122631683 14:103110129-103110151 GGCCTCCGCACCCGCCGCCCCGG - Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1123162049 14:106287730-106287752 GGCCGCCGCACGTGCCGCGCGGG - Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124469298 15:29968889-29968911 GCCCGCCGCACCCGCAGCTGCGG + Intergenic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1126800780 15:52295296-52295318 GGCCGCCCCCTCCGCCGCTCCGG - Intronic
1126849868 15:52790365-52790387 CGCCGCCGCCGCCGCCGCAGCGG + Intronic
1128067853 15:64775591-64775613 TGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1129675980 15:77632641-77632663 CGCCGCCGCCTCTGCCGCTGGGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130335261 15:82952608-82952630 GGCCGCCGCATGTGCCGCGCGGG - Exonic
1131257378 15:90871547-90871569 GGGCGCCCGAGCCGCCGCGGCGG + Intronic
1131735469 15:95326945-95326967 TGCCGCCGGATTGGCCGCGGCGG + Intergenic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132662008 16:1065813-1065835 GGGCAGCGCATCCTCCGCGGAGG + Intergenic
1132934822 16:2474990-2475012 GGCCCCAGCTTCCGCCGCTGCGG + Intergenic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1135296537 16:21283933-21283955 CGCCGCCGCCTCCGCCGCTGCGG - Intronic
1136129620 16:28211677-28211699 GCCCGCAGCCTCCCCCGCGGGGG - Exonic
1136365428 16:29807069-29807091 AGCGGCCGCAGCAGCCGCGGCGG - Exonic
1136556496 16:31010496-31010518 GGGCGCCGCGGCCGCTGCGGGGG + Exonic
1137708028 16:50548668-50548690 GGCGGCGGCAGCCGCGGCGGCGG - Intronic
1138252073 16:55509195-55509217 GGCCGCCACTTCCGCCGCCTGGG - Exonic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141603766 16:85141687-85141709 GGCCGCCGCATCTGCCTGGAAGG - Intergenic
1141683375 16:85556632-85556654 GGGAGCCGGCTCCGCCGCGGCGG + Intergenic
1141797826 16:86286732-86286754 GGGGGCAGCAGCCGCCGCGGCGG + Intergenic
1141840131 16:86568582-86568604 GGAGGCCGCCTGCGCCGCGGCGG - Exonic
1142163333 16:88570625-88570647 GGCCGCCGCCGCCGCCTCGGCGG - Intronic
1142239775 16:88939956-88939978 GGCCGACCCGTCCGCCGAGGTGG + Exonic
1142417004 16:89948709-89948731 TGCTGCCGCCTCCGGCGCGGAGG - Intronic
1143148265 17:4790184-4790206 GGCCCGCGCCTCCGCCTCGGTGG - Exonic
1144269113 17:13600828-13600850 GGCCGGCGCCTCCGCCACTGCGG + Exonic
1146219839 17:31008727-31008749 GCCCGCCGCCTCCGCCGCTGGGG + Intergenic
1146332338 17:31937419-31937441 CCCCGCCGCTGCCGCCGCGGAGG - Exonic
1146716245 17:35089191-35089213 GGCTGCGGACTCCGCCGCGGCGG + Exonic
1148564472 17:48625103-48625125 GGCCGGCGCATCCGGGGAGGGGG + Intronic
1148852194 17:50560800-50560822 GGCAGCGGCAGCCACCGCGGCGG + Intergenic
1148852197 17:50560811-50560833 CGCCGCCGCAGCCGCCGCGGTGG - Intergenic
1150423169 17:65056599-65056621 CGCCGCCGCCGCCGCCTCGGCGG + Exonic
1150983361 17:70168992-70169014 GGGCGCTGCAGCCTCCGCGGGGG + Intronic
1151414488 17:73952647-73952669 GGCCGCCCCATCCGCCACCTGGG + Intergenic
1152077509 17:78168586-78168608 CGCCGCCGCTGCCGCCGCCGCGG - Exonic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153514492 18:5891383-5891405 GGCCGCGGCGGCGGCCGCGGCGG + Exonic
1153514493 18:5891385-5891407 GGCCGCCGCGGCCGCCGCCGCGG - Exonic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155054459 18:22171669-22171691 GGCGGCAGCAGCCGCGGCGGCGG + Exonic
1155199351 18:23503593-23503615 GGGCGCCGCGCCCGCGGCGGGGG - Exonic
1160861278 19:1238100-1238122 GCCCCCCGCACCCGCCGCGGCGG + Intergenic
1160864571 19:1251097-1251119 GGCGGCCGCCTGCGCCGGGGAGG + Intronic
1160873100 19:1285885-1285907 CGCCGCCGCACCCGCCGGGGAGG - Intergenic
1160930699 19:1568301-1568323 CGCCGCCGCCTCGGCCGCCGAGG - Intergenic
1161397778 19:4053939-4053961 GGACGGCGCCTCCCCCGCGGCGG + Intronic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162470892 19:10871558-10871580 CGCCGCCGCAGCCGCCGTGCAGG - Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1163546399 19:17943504-17943526 GGCCGCCTCCTCCGCCACGCTGG - Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163664163 19:18595232-18595254 GGCCGCTGCGTCCGCAGGGGAGG - Intronic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1165459514 19:35936461-35936483 GGCCCCCGCCTCGGCCCCGGCGG + Intronic
1165922661 19:39308380-39308402 GGGCGCCGGATCCCCAGCGGTGG + Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166876559 19:45901455-45901477 GGGCGCCGGGCCCGCCGCGGAGG - Exonic
1166882929 19:45940174-45940196 GGCCGCTGCAGCCGCGGCCGGGG - Exonic
1167237175 19:48322063-48322085 GGCAGCAGCCGCCGCCGCGGAGG - Intronic
1168064056 19:53909423-53909445 GGCCGCCGCCGCCGCCACCGGGG - Exonic
1168721769 19:58558393-58558415 CGCCGCCGCTGCCGCCGCCGCGG + Exonic
926717927 2:15939725-15939747 GGCCGCCTCCTCCTCCGCAGTGG + Intergenic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
929604243 2:43224814-43224836 CGCAGCCGCGGCCGCCGCGGAGG + Exonic
931253785 2:60553882-60553904 GGCCGCAGCGAGCGCCGCGGCGG + Intergenic
931254111 2:60555286-60555308 AGCCGCCGCCGCCGCCGCCGGGG + Intergenic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
934031861 2:88055595-88055617 GGCCGCCCCCGCCGCCGGGGCGG + Intronic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592618 2:104855840-104855862 TGCCGCCGCCGCCGCCGTGGAGG + Exonic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
936038322 2:109129642-109129664 GGCGGCGGCCACCGCCGCGGGGG + Exonic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942450899 2:176107580-176107602 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
942450942 2:176107705-176107727 GGCCGCCTCCTCGGCCGCCGCGG - Exonic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1169800338 20:9507089-9507111 CGCCGCCGCCTCCGCCGCCTGGG + Intergenic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1171531859 20:25858461-25858483 TCCTGCTGCATCCGCCGCGGTGG + Intronic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1174258796 20:49278262-49278284 GCCCGCCGGCTCCGCCGCCGGGG - Intronic
1174287771 20:49484198-49484220 AGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1175847004 20:62064797-62064819 CGGCGCCGCAGCCGCCGCGCCGG + Exonic
1176117967 20:63441375-63441397 AGCAGCCGCATCCGCTGCAGAGG + Intronic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176548598 21:8212235-8212257 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556492 21:8256443-8256465 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567529 21:8395270-8395292 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575431 21:8439485-8439507 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178487361 21:33027536-33027558 GGCGGCAGCAGCCGCTGCGGCGG - Exonic
1178992418 21:37366876-37366898 GGCGGCGGCAACCGCGGCGGGGG + Intronic
1179882677 21:44300096-44300118 GGCCGCCGCCATGGCCGCGGTGG + Exonic
1180650032 22:17369757-17369779 GGCCGCCGCCTGTGCCGCAGCGG + Exonic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1182236912 22:28883501-28883523 GGCCTCCGCAGCCGCCGCCGTGG - Intergenic
1182494223 22:30694933-30694955 GGCCGCCACAGCCGCCGCCTCGG - Exonic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1183525002 22:38317495-38317517 GCCCGCCGCCGCCGCCCCGGAGG + Intronic
1185055265 22:48575865-48575887 CGCCGCCACCGCCGCCGCGGCGG - Intronic
1185055267 22:48575868-48575890 CGCCGCCGCCACCGCCGCCGCGG - Intronic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185409301 22:50674091-50674113 CTCCGCCGCACCCGCCCCGGTGG + Intergenic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
1203253481 22_KI270733v1_random:128538-128560 CGCCGCCGCCGACGCCGCGGCGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203261536 22_KI270733v1_random:173618-173640 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
950316324 3:12004677-12004699 GGGCGCCGCCTCGGCCTCGGCGG + Exonic
951543608 3:23806040-23806062 CGCAGCAGCAGCCGCCGCGGCGG + Exonic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952929258 3:38346954-38346976 GGCCGCCTCCTCCGCTTCGGTGG + Intronic
953657009 3:44862080-44862102 GGCCGCCGCCTCCGCCAAGCTGG + Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956675041 3:71725331-71725353 GGCCGCCGCGCCCCCCGCCGGGG - Exonic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
961665771 3:128492540-128492562 CTCGGACGCATCCGCCGCGGTGG + Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966362931 3:179148914-179148936 GGCCGCCGCCCCGGCCGCGGTGG + Intronic
966915830 3:184583718-184583740 CGCCGCCGCAGCCGGCCCGGGGG + Intronic
968084913 3:195869921-195869943 GGCAGCTGTATCCGCCGAGGTGG - Intronic
968616555 4:1580249-1580271 GGCCGCCGAACCAACCGCGGAGG + Intergenic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
971327430 4:25655737-25655759 GCCTGCCGCAGCCGCCGCCGGGG - Intronic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
972725831 4:41745992-41746014 GGCCGCGGCAGCGGCGGCGGCGG - Exonic
975616474 4:76252093-76252115 GGCCGCAGAGTCCGCTGCGGAGG + Intronic
976390038 4:84497791-84497813 GGCCGCGGCAGCAGCCGCGGCGG + Exonic
977693905 4:99946695-99946717 GGCCGTCGCAGCCGCTGCCGCGG - Exonic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
983923425 4:173371227-173371249 GGCCGCCGCAGTGGCCGCAGTGG + Exonic
985696698 5:1344954-1344976 CGCCACCGCCACCGCCGCGGGGG + Exonic
985995788 5:3596197-3596219 GGCGGCGGCAGCCGCCGCAGCGG - Exonic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
986858966 5:11904306-11904328 CGCCGCCGCCTCAGCCGCCGAGG + Intergenic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
993900508 5:93581273-93581295 AGCCGCCGCTGCCGCCGCCGGGG - Intergenic
994353892 5:98774097-98774119 CGCCGCCGCTGCCGCCGCCGAGG + Exonic
994354008 5:98774585-98774607 CGCCGTCGCAGCCGCCTCGGAGG + Intronic
997302078 5:132813630-132813652 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
997302080 5:132813635-132813657 GGCAGCCGCAGCGGCGGCGGCGG - Exonic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
997975412 5:138439076-138439098 CGCTGCAGCAGCCGCCGCGGGGG - Exonic
998203901 5:140145910-140145932 AGCCGCAGCCGCCGCCGCGGCGG - Intergenic
998203902 5:140145913-140145935 CGCAGCCGCAGCCGCCGCCGCGG - Intergenic
999188523 5:149730472-149730494 GGCCGCAGCTGCAGCCGCGGAGG + Intronic
1002591074 5:180291981-180292003 CGCCGCCGCCGCCGCCGCAGTGG + Exonic
1003206947 6:4021387-4021409 AGCCGCCGCCACCGCCGCCGAGG + Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004864281 6:19837873-19837895 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1006302352 6:33200321-33200343 CGCCGCCGCCGCCGCCGCTGCGG + Exonic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1010083050 6:71886579-71886601 GGCGGCCGCTGCCGCCGTGGAGG - Intergenic
1011517368 6:88167428-88167450 GGCCGCCGCTTCTGCCGAGGAGG + Intergenic
1013507598 6:110815348-110815370 AGCCGCCGCCGCCGTCGCGGAGG - Intronic
1013575803 6:111482958-111482980 GGGCGCCGCCGCCGCTGCGGAGG - Exonic
1013793701 6:113860467-113860489 GGCCGCGGGCTCCTCCGCGGGGG - Exonic
1016010791 6:139135629-139135651 CGCGGCCGCAGCCCCCGCGGCGG - Exonic
1016329871 6:142945118-142945140 GGCCGCCGCAGCCGCAGCGGTGG + Exonic
1016400783 6:143677981-143678003 GCCGGCCGCAGCCGGCGCGGCGG - Exonic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017672072 6:156778048-156778070 TGCCGCCGCTGCCGCCGCGGAGG - Exonic
1017672364 6:156779108-156779130 GGCCGCCGGCTCGGCGGCGGGGG + Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1020238559 7:6374799-6374821 GGCCGCGGGATCGGGCGCGGAGG + Intronic
1020395808 7:7716656-7716678 GGCCGGCGCGGCCGGCGCGGTGG + Intronic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1022103806 7:27184599-27184621 AGCCGCCGCCGCCGCCGCGGAGG + Exonic
1022106270 7:27199880-27199902 TGCCGCCGCAGCCGCCGGGTGGG + Exonic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1027374582 7:77537373-77537395 TGCCGCCGCAGCCGCCGCCTAGG + Exonic
1029123195 7:98281726-98281748 CGCCGCCGCGTCCCCCGCCGGGG + Exonic
1029456218 7:100673843-100673865 CGCCGCCGCCTCCGCCGCGGAGG + Exonic
1029640258 7:101815903-101815925 GGCCGCCGCCGCCGCCACCGAGG - Intronic
1029730124 7:102433482-102433504 GGCCGCCGCAGCCGCTGCCAAGG - Intronic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1031317371 7:120273813-120273835 GGCAGCCGCCGCCGCCGTGGCGG - Exonic
1031604145 7:123748696-123748718 AGCAGCCGCCGCCGCCGCGGAGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1032174359 7:129611698-129611720 TGCCGCCGCCGCCGCCGCCGAGG - Exonic
1032306032 7:130733485-130733507 GGGCGCCTGATCCGCGGCGGGGG + Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034437808 7:151071434-151071456 GGCCGCCCCGTCCGCCGAAGGGG - Exonic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034491617 7:151396016-151396038 GGCCGCGGCCTCCTCCGCGCAGG + Exonic
1034781528 7:153886670-153886692 GGCCTCTGCATCCGCCGCCGCGG - Intergenic
1035169538 7:157009945-157009967 CGCCGCCGCCGCCGCCGCTGGGG - Exonic
1035265588 7:157688965-157688987 GGCCGCAGCACCCTCCGCGCCGG - Intronic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035751684 8:2001356-2001378 GGCCGCGCCTTCCGCCGCTGAGG - Exonic
1036789498 8:11708666-11708688 GGCCGCCGCCGCCGCTGCCGCGG + Exonic
1036789499 8:11708668-11708690 GGCCGCGGCAGCGGCGGCGGCGG - Exonic
1037535224 8:19817434-19817456 CGCCGCCGCCGCCACCGCGGGGG - Exonic
1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG + Intronic
1039454296 8:37697294-37697316 GGGCGCCGCCTCCGCAGCCGCGG + Exonic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1044719849 8:95134294-95134316 GGACGCCGCCGCCGCCGCGGGGG + Intronic
1045222577 8:100213258-100213280 GCCCGCCGCCGCCGCCGCAGAGG - Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1045583219 8:103500803-103500825 GGCTGCCCCAGCCGCCGCGCCGG + Intronic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049678157 8:143902696-143902718 GCCCGCAGCAGCCGCCGCCGTGG + Intergenic
1052192792 9:25678180-25678202 CGCCGCCGCCGCCGCCGCTGGGG + Exonic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053434822 9:38067955-38067977 GTGCGCCGCCTCAGCCGCGGAGG - Exonic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514211 9:77020338-77020360 GGCGGCCGCGGCAGCCGCGGTGG + Exonic
1055514227 9:77020407-77020429 GGCCGCCGCCGCTGCCGCCGCGG + Exonic
1055936832 9:81611789-81611811 AGCCGCCGCGGCCGCCGTGGTGG - Exonic
1056475396 9:86947234-86947256 CGCCGCCGCCACCGCCGCCGCGG + Intergenic
1057488563 9:95505899-95505921 GGCGGCCGCGGCCGCCGCGCTGG - Intronic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1059102194 9:111482817-111482839 GGCCGCCCCGCCCGCCGCCGGGG - Intronic
1059102396 9:111483513-111483535 GGCCGCCGCCTCCGCCTCCCAGG - Intronic
1060389799 9:123268217-123268239 GGCCGCCGCCGCCGCCGCTGCGG - Intronic
1060480682 9:124015362-124015384 GGCGGCCGCTGCAGCCGCGGCGG + Exonic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1062314799 9:135961344-135961366 CGCCGCCGCAGCAGCCGCCGGGG + Exonic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203469882 Un_GL000220v1:111687-111709 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477703 Un_GL000220v1:155659-155681 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1190008060 X:46758953-46758975 GGCAGCAGCAGCAGCCGCGGCGG + Exonic
1190285373 X:48957713-48957735 CGCCGCCTCCTCCGCCGCCGAGG - Intronic
1192657090 X:73003386-73003408 GGCCTCCGCCTCCCCCGGGGTGG - Intergenic
1192657146 X:73003560-73003582 GGCCGCCGCAGCCGCCACCTCGG - Exonic
1192664974 X:73079447-73079469 GGCCGCCGCAGCCGCCACCTCGG + Exonic
1192665030 X:73079615-73079637 GGCCTCCGCCTCCCCCGGGGTGG + Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1196016355 X:110944462-110944484 GGCCGCCGCCACCACCGCTGCGG + Intronic
1198807145 X:140503978-140504000 GGCCGCAGCTGCGGCCGCGGCGG + Exonic
1198807224 X:140504332-140504354 GGCCGCGGCAGCGGCGGCGGCGG + Exonic
1198807225 X:140504334-140504356 GGCCGCCGCCGCCGCTGCCGCGG - Exonic
1200092489 X:153642449-153642471 AGCCGCCGCCGCCGCTGCGGAGG - Intergenic
1200092490 X:153642452-153642474 GGCAGCCGCCGCCGCCGCTGCGG - Intergenic
1200100951 X:153688893-153688915 GACCCCCGGAGCCGCCGCGGAGG + Intronic
1200277864 X:154751164-154751186 GGCCGCCGCGGCCCCCGGGGAGG + Intronic