ID: 1185903426

View in Genome Browser
Species Human (GRCh38)
Location X:3914835-3914857
Sequence GTCACCGCCTCGTGTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185903426_1185903435 18 Left 1185903426 X:3914835-3914857 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185903435 X:3914876-3914898 TCACTGGGCGATTCCTCCAGGGG No data
1185903426_1185903433 16 Left 1185903426 X:3914835-3914857 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185903433 X:3914874-3914896 CTTCACTGGGCGATTCCTCCAGG No data
1185903426_1185903434 17 Left 1185903426 X:3914835-3914857 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185903434 X:3914875-3914897 TTCACTGGGCGATTCCTCCAGGG No data
1185903426_1185903430 3 Left 1185903426 X:3914835-3914857 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185903430 X:3914861-3914883 TGGGAGCACCCGTCTTCACTGGG No data
1185903426_1185903429 2 Left 1185903426 X:3914835-3914857 CCAAGGGAACACGAGGCGGTGAC No data
Right 1185903429 X:3914860-3914882 CTGGGAGCACCCGTCTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185903426 Original CRISPR GTCACCGCCTCGTGTTCCCT TGG (reversed) Intergenic