ID: 1185903578

View in Genome Browser
Species Human (GRCh38)
Location X:3915490-3915512
Sequence ACTCGGCCCAGAGGTTGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185903578_1185903586 14 Left 1185903578 X:3915490-3915512 CCTCGACAACCTCTGGGCCGAGT No data
Right 1185903586 X:3915527-3915549 AAGTCGCTCCTGCCCGCATGGGG No data
1185903578_1185903584 12 Left 1185903578 X:3915490-3915512 CCTCGACAACCTCTGGGCCGAGT No data
Right 1185903584 X:3915525-3915547 GCAAGTCGCTCCTGCCCGCATGG No data
1185903578_1185903585 13 Left 1185903578 X:3915490-3915512 CCTCGACAACCTCTGGGCCGAGT No data
Right 1185903585 X:3915526-3915548 CAAGTCGCTCCTGCCCGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185903578 Original CRISPR ACTCGGCCCAGAGGTTGTCG AGG (reversed) Intergenic