ID: 1185904387

View in Genome Browser
Species Human (GRCh38)
Location X:3920321-3920343
Sequence GCGTCCCCATGAAGGCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185904387_1185904405 24 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904405 X:3920368-3920390 GGCCGGAGCGCTCGGGGAGCCGG No data
1185904387_1185904403 18 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904403 X:3920362-3920384 GGGCCGGGCCGGAGCGCTCGGGG No data
1185904387_1185904406 25 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904406 X:3920369-3920391 GCCGGAGCGCTCGGGGAGCCGGG No data
1185904387_1185904395 -2 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904395 X:3920342-3920364 GCACTCAGGTCCGGGGCGCCGGG No data
1185904387_1185904397 3 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904397 X:3920347-3920369 CAGGTCCGGGGCGCCGGGCCGGG No data
1185904387_1185904401 16 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904401 X:3920360-3920382 CCGGGCCGGGCCGGAGCGCTCGG No data
1185904387_1185904396 2 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904396 X:3920346-3920368 TCAGGTCCGGGGCGCCGGGCCGG No data
1185904387_1185904394 -3 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904394 X:3920341-3920363 CGCACTCAGGTCCGGGGCGCCGG No data
1185904387_1185904392 -10 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904392 X:3920334-3920356 ATGGGGACGCACTCAGGTCCGGG No data
1185904387_1185904398 7 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904398 X:3920351-3920373 TCCGGGGCGCCGGGCCGGGCCGG No data
1185904387_1185904402 17 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904402 X:3920361-3920383 CGGGCCGGGCCGGAGCGCTCGGG No data
1185904387_1185904393 -9 Left 1185904387 X:3920321-3920343 CCCGGGCGCCTTCATGGGGACGC No data
Right 1185904393 X:3920335-3920357 TGGGGACGCACTCAGGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185904387 Original CRISPR GCGTCCCCATGAAGGCGCCC GGG (reversed) Intergenic
No off target data available for this crispr