ID: 1185909811

View in Genome Browser
Species Human (GRCh38)
Location X:3971113-3971135
Sequence CCTGAAGGACTGTGGGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185909802_1185909811 23 Left 1185909802 X:3971067-3971089 CCACGGCAGTTGGGTGCGCAAAA No data
Right 1185909811 X:3971113-3971135 CCTGAAGGACTGTGGGTATAAGG No data
1185909806_1185909811 -10 Left 1185909806 X:3971100-3971122 CCCTGCTTCAGCACCTGAAGGAC No data
Right 1185909811 X:3971113-3971135 CCTGAAGGACTGTGGGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185909811 Original CRISPR CCTGAAGGACTGTGGGTATA AGG Intergenic
No off target data available for this crispr